Description :
Non Conding Region
Location :
Scaffold_1:120445- 121018
Sequence
573 bases(100 bases per row)
TTAAGCTCAATCATCAGCTGTTCGTTCTTGAGTGTCTGATGTGTCATCGTCCTCGACCGAAGCGCTTGGGCGTCCCGTCCCGACTGGTGAGCGGAATAAG
GGAGGCAGTTGGAAATAGCCACCTCTGCGCGTGCTTCTCTCCTCTCATGTGCCACTCAGTGCCTGTTAAACCTTGTCTGTCATGCCCGTGCCTCGCCCTC
CGTCCTACTACGGCGTGTTGCCACCGTCATCTCCTGCCCTTCCAACGCATCCCACTTCGTTCGCAAGCGTCACAGACCCGACGTTGCACCGCCATGGCTG
GCGGAGTCCTCGTGCCACCACCCACAGTGACGCTCCTCGAGTGCCGACTCGGAAGGTGCGGAGCTCGTCACTCGCCTGTGGTAGTCGGTGTTTAACGTCC
TGCAGTGTAGATCCCATCTCGGTATCGCTCGCTTCTTCGCTATGACGCACTTTCATCGCCTTCGTCACCGCTCCTCATGCAAAATACCACATCCTCATCG
AATGCCTCGGCCCATCGGCGTGCGTCCAGCAGGTCGGTCATCTCGTCTCGATCACGAAGCACGTCGGTCACAA