Description :
Non Conding Region
Location :
Scaffold_1:120403- 121176
Sequence
773 bases(100 bases per row)
CGCTGATAAATGGCCAATCACATGGATCTAAGGGATCGATACCTGCAATGTTCCGATCAGCGAATGTAGCTAACGTACGCTGTACTTAATGTCATTAATT
TCGATGCTCTAGAATGTTCGAAGCAAACGATTGGCTGTAAGACGCTCGTACAAATCGGAATCTTTCACATTCATCCTTCAGAACACGATTTAGAATTGCA
GAGTCAAGTGGATTCTCGAAAGGGAATGGCTTGGGGAAATTCCCCGGACACCAGGGTAGAGAGTACCAGCGTTGATTCGCGGCCCCCTCGCTATGCAGCC
TTTGTGGGCGACGAAGGATATCTCTTTAGAGACGTCTGGAGCTTCTACGGTGAATTTGGCGAGGACTGATTGTCTGAATAAAAGTTATGCAATTGGCTTC
ATGATATGGCAGAGTCGTGCTGTCTTCATGTTTGAGCTAACTCGACGGGGATTACTCAAATCGTGTTCTCCACGACACTATTCTTCCGTGCGATGATGAT
GGATATTCCCATAAACATTCGCAGTGTTGTTGCTGACAGTTTTCAGATTGCCGTCTGATTCCAACTGAATGAGGCTTCAAATTTCCTTGGATGTCTGAGC
ACAATATATCGAGTACGAGGATTAAACATTATCATGCGCGTCGTTTGAAATGTTTGTTGATGATACGAATTTGCTATTTCCATTCAATTTTTATGAGTAC
TCTTGTAATTCCTGTCAAGAGACCTGACACTTAATCAAATTCCATCACATTGTCTCCAATTCTCATCTTCTAA