Description :
Non Conding Region
Location :
contig_1:120397- 121920
Sequence
1523 bases(100 bases per row)
ATCGCGAGTGTTTGGAGGTTCGTGAGCGGCGTGAAGCAAATTGGGGAATGACATGCTGGTGGCGGTGGCAGACTGCGGAGCTTGTTGTAGTGTCCCGCTG
TTAGAGAGGGTGCGGCTGCCCGAAGCGATCGTATCGGCACGGGCGAGGACGCCCTGATCGGGTTGCACACGCGCTGGGTGCATCTATTGAGCTCGGATGA
TCCATCTGCTTTATCGTGGATGTCATGCGACTAGCAAGACGGTATCCTGTTCGATTTCGCCATCTGCCACTCCGACATGGCGAAATGGAGAGACCAGGCG
GCGGCGTGCTGATGCACCGCTCGATTGAAGTGAGCGTAAAACTTGACGCCCCTAGGTGACCCCAACAAAAACACTATGGTTACAGCGGAGGGATATGCGG
TTGGACCAGACAGTTGTGGCGTCGAGTTGCTTACCGGTACGTGTATGCAGGTGACATCGATGGTTTACACACATCCTAGGGTACCGATGTTTTATACAAG
TTTTGAATGCTGCGAGGATGTGGCACTCGAAATGCCCAAAGCTACGAAGGCATCCAGACTGGCGCAGGATGCAATCCACTGGGGGCAATCAACGTGCTTG
GTTCGTTGCATTCATCTTTGCAGCCCTTGTTCCAAATACACTGTATACACACAGTAGGGACTTCCCATGAAAACGAGTTGGGGTGCAGTGTGAACTGGCC
ATAAAACGGGTGTGGAGTTCTGCGTAGACCTCGGTGGCTTACGAGACGCTGCTCGGCTGCTTGCTTCCCAGAGCGTTGAGTAAATTCTACAATTTTCAGC
ACAAAAGTGCAACGTTTACAAACTTCTACTCGACAACGAAACTACATGGCATGCAGTACATCTGTCTACAATGCCACCAGGTTACCTCTACTGGTAGCCA
AAACGTTTCGTTGTCCGTCGCGGCACGACTGTGAAGACCACCAACTACATCAATGTCTGTTGGCGGAACAGGTAGTAGTGTGACGGTCGGTAGTACCTAC
GACCTGCCTCTATGGAAACCTTAGCTAGACGCAGCAGCATCCAGTGTGTGGTGGCTCAAGTCGAGCACCATCATCAAGTTGAGTGGCGTGCTTGAACTTG
GACGATCAGCAATGGTAGGTAGGGGCGTGAAACATTCATTGATTTAGTTCAGTTCACAATAAGCAACCCAGCGAGCAATACACTCATTGACCGTTATTTA
CCTAAAAAACGTTAAATTGGTGTTCCTATCGCCATGTTGGGAATAGTACCAAAACCTTAATTCGTAAGTCCTCGGTGACCCCATTCAGCCTTCAAAAATA
GCATTCTCGTCTTCGTGACCTTGTCTGCGTCGTCCCTGCCCACCTATGTAGCCTATCTGCGTTGTTGATGCCCTGCTAAAGTGTTTCATGCCTCACCAAT
CAACACCGTATTCTCAAATAGTCTCCCCAGTCACTACAAGCCCCCGCAACCCTCCGCTTAACCTCTCAAGCCTCCGCTCCTCGCTTCTCGTGCTGCTACA
CATATTGAAGCCGCAACGAACAA