Description :
Non Conding Region
Location :
Scaffold_1:120305- 121484
Sequence
1179 bases(100 bases per row)
CCGAGGAATTGTATCGCTATCTTCTGCGGAGACCAAGCGTCGAATGGCGATCTTCGGACAACTTCAACACCATTTGATTGGCTAAGAATCTTCTGACTAG
TTTTCTGCCTGGAGTTTTGAAGCCATTTTCGGTAATACATATGCGTGCTACTCGACGAGTTTTCTTATGCGCGTTGGGCGTACACGTAGCGTGCGTGCTT
CGAGTTGCGAGTCTCGGTGCCACACGAGCATTTGCAGTGCTCTCTGCGTGACGTCCTGCCAGCGCCGCGTCCACGACTCGTGAATCACGAGGGCCAAACA
AGAAGCTGGTCGCCGATCGCCAGGTACAGCGCCGTGGGTACGCTCAGGGTGGCTAGCAACGAGGGCTGGTCTGAAGGCCAGCCGAATTGCTGTTTACTGG
CCACCGTTTCCGCCGCTGTTGGGTCAACTCGCGAGTGGGATGTCATCCAGTCAAGAGCTTAGCCCGACGACGACGATGACGAGGGGCTTGACCGTTGTCC
ATGTCTCCTCACAGCAGCAGCAGCCGCACCACTGAGTGAGATACACTCAGTAACGGATACGGTGCCAGCTCCTTTCGAGCAAGCTCTGTTCGGCCCAGGC
CACAACATCCCATGCAGAGGCTTCCCGGAACGGAAAAAAGCTGCAATCGAGCACGGGCTCTCAGACCCAGTGGAAATATCCATCCAGGTTCAACTTGCGG
GTAGATCTGGGTTCACTACATGTATATAACTCCATGTATCTGGTAAGCTTAGAGTACATTGTAGGCAACAAGCGCAAATGCAGGCATTGCCGTCCTTGGT
GGCGTGTGGCAATCCGCTTTCGTCTCGTCGTCGGTCTCCGACGTCTGTCCCCGCAGCTGTTCCCCCACTTGCTTTTTGTATGCCGAGGCGTAAAGGGTTG
TGTGTGCGCGGCAAGTACTTGACCATCACCTCGCTCAAAACAAGGAGTCAGTTTTTCAACGGTTCAGAGCGGCAAGGGCGTCCCGTCGCCGCCTTGTGTA
TCATCGCGCTCGAGTGCCTAGTGCGCGTTGCATTGCCCAGAAGCCTCTCTATTGCTCACTCGCGAGGGGTACGGAGACCGTCCAGCCAGGCCATCGCAGC
CAGTTCCAGGCTTGGACCCCCGCCCACAGGCTCCCGCTCACTTGATTCAGGTCACAGGGGACTCGGAACGCGTCCAACA