Description :
Non Conding Region
Location :
Scaffold_1:120279- 122096
Sequence
1817 bases(100 bases per row)
AAATTCGGAAGTGAGCTGATTGATGTGATCCGCTGGTCACTTTTTTAGCTCGGGCTTGCCTTGACACGTAGAGTGGCCCTTCTGAGCGAAAATGGGGGGA
TGGGCTCACTCCGGCGCGGCTAGGGCTAATTTGTGGCTCGGAGTCGTCCCTGGCTAAAAGATTGACCAATGGCAGCTGGGCTGGCCCGCCGGCTCCTCTG
TTCAGTTCCAGTACAGTAGGCCGCGGTATCTCAGATGGGCGCTAAATTTATCGGTAATTTACGCGTCGAGGCGGTGCGAGAACTGCTCGCCAGCAGGGCC
TGCGGGCATGTGCGATGCCCGAGCGCGGCTTGTATGCTGAAAACAGCCCGTGCACCAACTTGCGGCGCGCAGTAGTCGCCGCGCCAGGCGGCTCGCAGAG
CCGCGCTGGCCAGTTGCGGCCGCCGTAGGCTATCCAGTGACAAGGTCAGAGTGATGCGCGTCAACTACTTACTGTTTCAACTCGGCACTGCCGCAGTCGG
TTGCGCTTGCAGTGCAGAATGAAAACCGCCTGCGAGACCACGACAATGCGAAAGGCATTTCGCCCGTGATCTCCGCTGGAAAACAGTAACCGCAGCAGTA
TGGACAAGATGCAGCATCGCAACAACATCGCACGCAAATAGCATGTAAAGGCCCTGATCTGAGCCGGTTGGCATACTTTCGCGTCGGAGTTCCCCGTGCG
CGTCTGTTTGTTCTGAGATCACTTGCGGTCGCACAACTGGAATTTCGCCATGGAGGGGGGGGGGGCACTGTGGCTCCTTTTGCCGCCTCGGGGCAGATGT
CGGAATGCTTGGCTCAGAAGTGATTGCGTCGTCCTAGAACGACCGACCTAATCGTATAGACAGCGGCATTTCCGAAGTCTAATCGACTATACCGAAGTGG
TTGAGCACTAGTCCGTTGCGACTGCGCGGCGGCGACAGGTGACAGGTGACAAGCCTTGGAGAGGCGATCCAGTCTGCGCACCGTCACCACCGACTCACTA
ATCCCCCCGAAAACCAACTGTCCGTCTTCGATTGCGAAGGAGTCCACGTGCGCCGGCGGTATCGTATCGTGAGAAGGAAGGCCCACGTTTTCAAAGATTG
CAAGAAAAAATAAATTACTTCCGCATCCTTTGCGGTGGCATACTTGCGACACGCGCATGCCACTTGATGGTTCTCTGGCGGTGCTGCGTTCTAGAAAAAG
ATCGCAAAATTGAAGTTGCTCTGTGTTGGAGGATTTCTGTTTTTAACAGCGCGAGACTAACGGCGCCTCGCTCAATGCAGTGCGGCCTGCACACTGCTAC
AGCCTGCCAGACGCAACGCCGGCGGAGACGCGCCAGTCCTTCGGCCGCCTTCCTCTCGCAGGCTTTTCTTTTTCTCCCTTCGCTTGCGCCGCGCTCGCAT
GGCTTTAGTCCAGCAGAGTGGCATGGGCCGGCTCAATGCGGTTGCATCAAGCGGATGCTGACTCCGCGCACAGCGCTGGTTGTGTATGAGACACCGCCTC
TTTCCACCGCCGCTCGCTGCATGCGAGGGATGACGGGCAACGCTCGCTGCGACGCCGTCGGCTCTTCTAGGGAGCACCTCCGCTCGCTCGCGGCGGCGCT
CCTCCACATAGCTTTGCATTTTTTGAGTGGATTCCTGCAATGGCTGCGCGCCCAACGCGCGGCAACTCTCAACTCTCGCTCACCCGGCAACACAACCTGC
AGTACCCCTGAAGGTGCTTGAGCGGGCGAGCGGCGCGCAGCGAGCCCCGGCTAGGAAAGCTCCGAGCACTTCAACGTGCCGCGGTGCCGGCGTGAGTCGA
GCACCGAGGCGGAGACA