Description :
Non Conding Region
Location :
scaffold_1:120100- 121048
Sequence
948 bases(100 bases per row)
CAAGTTTTTCCCGGCCGATTCATGCCGTTGAGTGCCAAGGAAAAAGATCGGCCGCGATATCAAGAAGAAAAGCGACCTCAAACAGCTAACCTTGCAGGAA
TTTAGACAAGATTTTCCATCAATGCTGCATCAATCGTGATTTCTCTCAACCTGAAGAACTTCTACGGTCATAATCTGTTAGTCAAAGGCATTTATCTTCC
AGATGCTTGCAACAGTGAGGATGCTACTCCTGTTGTTGTCGATGTGCGTAAATTGGAAGTGGCGATAAGCATCCAGCAAAAAAGACAACGACCGCGATGG
GGTTACCTTCGCTGCACCCCTAGCATTCATGTAGTTGCCCTTGCTCAGCTTTGTCGGGGGTATACAGTGTGAGCTTTCATCCTCGCTCTGATCATTGCAA
GGGTTTTTGCGTCTGCCAACCTGGGCATCGCTATTTCACCAGGCTGCGGGCTGGGCTGATCGTTGCCGGATGCTGTTTTTTTCGTACCATCAGCCACGAA
AGCGTGTTTCGTACGGAGTTGGACAAGTTCTTCTGCAACCAACGCATCAACGAGGTCAGCACTCAAGAAGGTAACCTCGACAAGCTTCAGGAAATATTTG
GTACGACTTCACCAAACGCGCCGCCGAGGTTCGACCCGATAGAACGTGTGGGAATATATGCCCCTTTATTAAAGAGGTGACCTCGATCTCATTTTCCGAA
CACGTTTCTTGGACTCCTGCAATACCACGGATAAAGTAGACAAGTGGTGCGGACACCGGACTATGGGACTTCCTACAAACACATCTTCGCTGCTGACTCC
ATTCTCAGTGAACCCGGGAAAGTATCGCTCATTTCAGAGACAAGAGCGTGAAAGTGAATTCGATTGGTTGGAATTGGTCGTAGCATGGCTACTACCTCCA
GCAAAATCGCCGCAGTAGCATGCGTGAAGCTGTACAAGTCGAGCCATT