Description :
Non Conding Region
Location :
Scaffold_1:120055- 132007
Sequence
11952 bases(100 bases per row)
TTCAAAGCAGAAATGGAAATGGGAAACATGGTTGAGACCAAGCTGTAATCGCAGTCAACAATGTAGCTGGTAGTGAATTTACATGTTTATGGAACCTTTC
AGAAAAAGATTCACGCTAAATTTTTATCCGATGAGAAAATCGTTATCATTTTTGCATTTGTACCACGTTACGTTATCAGTTGTACAGCCTCAGCCGCGAG
TGAGTTTTTCGTCTTATTACCTATCGTCATTAACGGTACAGGAATATTGACGTGGCACCTTCTATTGTGATAAAACACATTTTGCTTAGCTTTGTTGTTC
ACCACGGTGTTGGTTTTCGCCTCGCGACCTCTTTCTATCCCTTCGGCCGAAGCCCCGTACGACTGTACACAAAGCAAGATTATGCCTGTAATTGTGCTAC
TGTACGTACGATATGTACTCACTACTGTTCGTACTCCCGTACGTACGCGGTAACTATCATTATGGTTGCGGATACCTCCATTCGTGTTCGTACGGGGGTA
CGTACGTTTTAACAAATACCACGACGGGTGATGCCGTATCTGGTTGAAACTGGCCAGATGCACTGCATCGTGCAGGCGATCAACTGCACCTAATGGAACT
CCTACAGGCCTGACACGCGTATTGCTAGTGTGTCGGTGCAATTGAATGTATCTGCACCGATCCGAAACATGCGGCAGCTACTTGATGAGCTGGAGCGCCA
GCTTGCCAGCCACGGCGTTGTTCAGCACATGGATTAAACTTCTGTGAAGGCAGCTGGTCGAGACAGCGAACCCCTCCGTCACTATGCCAAGGTCGTCGAA
GCACGCACGTGACATCCGCACGTACGGGTGCGGCGCGTACTCGATCTTAGCAGTTCGACTAAATAATACAACTGTCTTGCAGTTGTCACATAGTTGAGTA
CCTTTTGGAGGGCTAGCAGATCGAAACTTTGTACTGATATGTGATATAAACATCAGCCAATCAAATGGTCTAATAAGCGTGACACACTCAAGGATCTCGA
ATTTATTATTATAGATACAGAATTTTTATCGGGGTTGAAAGGGTTAAGCTGGCTGGCGTGGCTCGTATATGCGAATCTACCCTCTCGTTTGTTAGAATCC
GCTGACGCGCGGCGACACGTCTCTGGAGCCGACCTCTGACGACATGTTGGTGTCGTATTTCGCTGCGGTGCGGATTGCAAAACACGCGGGTGGGGAGGCG
CCCCCTCGTCCGCCGTGGGCATCGTACTCTGAGAGACTGCGATACAGTCCTAGCCTCCGGTCCGGTGTACCTGGAGGTGCTGCGGGCGCTCAGGGGTTAC
ATACCTGCCGAAATCGGTATCGTCTTGGCGGTTGTACTTTCAGAAGTAAGCACTACCTGGTAGCTTTTGCTGTGTTTGGCCATGACGACACAACAGGAGA
GCGCGTATGAGATATGAGTGAGTCCATACTAGGCGTTACAAAACGAAGAATGAAAGCAATCATGAGCAATGGTGTAATACTGGAACATTTGGCTCTTGTG
ACATCCACAGACAGTGCCAAATTGTCCGTGTTGATTGTCTAGTAAAATGCTAGCTAGAGATGGTGATTGGTTGATTTCTACTGACTCTTCAAGCATGAAA
TTGGTTATTGCATGGGAAAAAACACCAAAATGAGTTATTGTCGGGCGTACCTGGTGATACCACGGTGCTGAGAAAGGAAGCAAGGACAAAATGATGCACC
GGATCAACGGATTGAGGGTACTAGCCTGTTCTGTGAACGATTAGAGACATAAACTAAACTAGTTGCAGCTGAGCATAATGTCTCAGCTGAACTTCACCGA
CGTGGATGAAGCTTTTACACATCGTTTTTTTCAGAAAAGAGATACCGTCGCTAGCTTATGTTTGAGTATGTACCAACGCAAGATCAATTCCCCACAGAAG
TGCACACGGCTTTGTCGAGGTAAGTCAACCCCCCCACCTCCTTCCGTTGCGCTCAGCACCGCGACACGTCTTTTGTCCACGCAATCTTGACGACGGCTGG
AATTGAACCAGCATCCAGAGGACATAGTCGCTTGCTTTCTCGTTAAGCTACGTCGGTGTGATGTGGGAGGTGTGTTCGTGTAGCACGGGGGCGTAACGCT
TGAGGTAGGGGCGGCGCGAGTTTCTGAGGCTTCGACTTAACGGCTTCGAGCCGAAAAAATGCGACAGCCCTACGATCTATCGGGTAGATGGACGCGTGCA
TTCATCTGAGGCAATTCATATTCTCAATTCATGTCAATTCTTTAAATTGTGGTCCATGCTTTGGACAGAGCAAATACCAAAAACCCCAGTAGAATTATCA
TCTCACACAGCAGAGTCAGCACGAGCACCGGCGCAACTGCCTTGCTCTGCTCTCACCGCCACACGAAACTCAGTACTGTCAGATACATATTTGTTGTAGC
TGATGTATTCGTCTAATCTCCGCCAAGATTCACACGTAAATCTACCCGTCCGAGCGCATAGCGCTACGCTCACGGCAAGGATCCCCGGGAATCGCATAGG
GTGCTGTTTGGACGACACGCCAAAACGACTGTGACTGCCCTGGAACGCGAGAGGCCTTCGGGCGAGAAGGCTACGAGTGCGCTGACGCGCGAGAGGACTA
CAACTGGCTGGATTGCGAGTGAACGACGGCTGTGCCTGTGCAGATATCGAGGCTGCGTTGTGGTTTTTGGAGTGTAGTTGGAATGGCGGGTTTGATTAAG
AAGTTAAGTGAGCTTGTGGACAATGGGGACTACGGAGATGTGGCGTACCTGGGACAGTGTACAACGGGAGCTGGGAGCGTCTAGCGATCGCTACGCCGCG
GACGGAATCTCCTGGGAGCGAACTGTGACCAGCAAGGCCCCAGCGCCTGTTTCTCAATGCATGCAACGATGTGGCTGCGTTTCGGGGGCAGCGTCGCCTC
AAGTAAACTTGCGCACCGATGTCAAACTTTTGCTCAATCCTGCTACGATCGTAGATGTCTGCCATGCGAGCTTGGGCGTCTTATAACGCATCCTGACACT
GCCGTAGTACGGCGGCCTGGCGCTCGGTGAATTGACATCATTACCAAGCCCGCCGCGTATGTCACGCCGAAGTGAGTCATAAACGGCGGTGCGTGGATTG
CGCGGGACGTATCCCAGATCAGCCGTAAATGGTGACACATTGGTGCTGTAGTTTAAGACCGAGTTGATGGCAGATTCCACATTTGCGAGGGCTTGGTGTG
GGACACGATGTAGTGGGCCTACCTTGGCTCGCTACTACGGCTTACACGTATGCGCACGTGTATGAGGAAGCGTAGGTTTCTTTTACTTGAGTTAAGTATA
CTCGAGATCCACGAGTATACTTTAAACAAGATAAAGACTCCAAGTAGCGTGTTTTGGTAAAAGATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTC
CTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAATGCTATATATGTCGCTCATTGGCTAAAAGATGCTGCTTTCAG
CCAATAGGAATCCTAAATGTGTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCTTTGGTGTGTCTACACCAAGGTCGAGGAAGTGTTCAAAC
CTCTAACAGACATCGCATCTGTTAGAGTAACAAGTGACTGTAGCCACTTGTGCGTGTAACTCTGTTACACCATCCCCCCGTCAAGGTTAGACGTGCCGGT
CCCGGCACGTCAACCACCATTGACCACTTGGTCAATGTGTGACGTTGAAGAGAGAGATGATGGAACGAGCGCGTCGAAGTTGAAGACCGCTGGCGCAGCA
GCGGAGAACCTCTCTGCTGTTGAGTAGAATGCGCGGCAACGTGCGAAGCGCGTCGCTGCCGCGGGGGCAGGTACCTATGTCTGCCCTCGAAGTGTCTTCG
GGCGCTGCTGTTAACAGCAGCGCTCGCATTACGTTTCAGTATGCAGCGCATGGTGGGCTTCGTATGCCCTCACCAAGTCTGGAACGTCTTGGAGCAAGAC
GTTCCGTGGCTCCCATGTATCTTGGTTGGGAGGAAATCCTCTCCAACGAATACGAAAACGAACTGGTTGCCTGTTCGTTCTCGGGATACTGTGATCAACA
ATCCGCTCAACAATCCATCGAGTTGAGCCGTGTGCATCACGAATCGGCGGCGGTGGTGGCGGAAACACGCCCCTTGTGTGGTCAACTTGGTGTTGACCCT
GATCTTGCGTCTCCCCACGACCGAGTTCCGGTCGTGGAGTACTCCCAGACCGCCTCGATCGTTCCGGCCGAGCTGGACCATTAGCCCGACCCGCTGCTCC
AGCGCGAAGTCGCGCTGGAGAGGACAATGGCTTCCGCCGAGTCTTCTGCTTCGGTTCAGCCGAGCTAGGTAGCTCGTGCTGCAGGTATGGCTTCAGCCGT
CCGACGTAGAACGTCGGATGGAGGCGCATACTAGACGGTATGTCCAGTGTGTAGGCGTTGCCGTGCCGTGCCAGCACAGTGAACGGTCCGATGAAGCGCG
GAGCGAGCTTGCTCGCCCCGAAGTCGGAAACTGCATGTTTAGGCAGGTTTTGACTAGCTAACAAGACTAATGAACCCTTCTCGAATTCATTAGTGTTGCC
CCTGCCAACATTGTCTGCGTTCAGCTTCTGTCGGTCGACAGATACTGCAATAGTGTCTTGGACAAACCGAATGACGGCTTGTCTGCGCTGCACGAAGTTG
ATTGCGTCCGAGCTGAACGAGTTCAGCTCGTTTCCAGCAGTAGGCCCGGCCTCTGCGTTCGTCTTCGTGGTGTCTGTGCCCTGCACAGACACGCTCTTCT
TCTTCTTGTTCTTGTTGGTGTCTGTGCCCCGCACAGACACGTTCTTCGTGCGCTTGTCGGCGTCTGTGCCCTGCACAGACGCGCGGTTCTTGGCTTTACT
TCGTGTCGTTGCGGCTGACACTGTACAAGTGTCAGCGGCATTCTGCGGCTGCTGCGTTGCAGTCGTAGATCCTCCCCCACTTGAGGAAGGAGTCACTATC
CCGAGTAGACTCGGGAGGCGTGGGTGCCTGATGGCATTCACGTAGAACGGTGTATGCCCGGTCGAGGCATGCACCGAGTTGTTGATGGCGAACTCCGCCA
TCGGCAGACACTCACTCCAGTGTTGGAACGAGTGAGCGTAGCTCTTAAGCACGTCTACGAGCACGCGGTTCACGCGCTCGGTCTGCCCGTCCGTCTGCGG
ATGGCCCGCAGTCGACATCGAAAGTTGGCTCCCAAGAAGTGTAAACACTTCTTGCCAAAGGTGTGCAGTGAAGCGCGGGTCTCGATCCGACACAATGTCG
ATCGGCATGCCATGGTGTTTGAATACCATGTCAACGAACAGACGTGCCGTCTGTTTCGCAGTCACTTCAGCAGGTACCGCAGCAAGATGGTACATCTTGC
TGAAGCGGTCAACAAAGACCACAACGCCCGTGTTCCCCTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATGGACTGCCAACACTCCGACGG
AGTCGGCAGTGACTGCAAGGGAGCCTGCGCGGAAGGCGCAGGCTTCACACGTTGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTAAACTGG
TGGGCCCAGTAGAAGTCTCGCGTGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAACCGGTGCATCGTGATACTCGTACATGATCCTGAGTC
GCAGGTCATGGTCAGTGGGCACGACAACGCGGTCCGCGTTGTCGTCGACTGCACTGTAGAGTAATAACCCGTCGTGCACCCGATAACGGTGTGCACGAGC
ACGAAGATGCTTCGGCAGCTTCTGACGAGCTTTGTCAGAAGGCGCTGAGCCGTAGGCCAGCAAGAGCTTCGTGTCCGCGTCGTGCGCGTACGCGACCTTC
ACGTCGTCCAACAGTGACGACGTTGGGGTGCTCGATCGCATGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGTAGTCAGGTCGACGCGAGAGCG
CGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCCGGGAAGAATGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGG
CGACTTCACAGCCGTCCGCAGCGACGCGTGGTCTGTGTAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCGAATGCGTACTTCATG
GCAAGGAGCTCCTTGTCGTGTACCGGGTAGTTGCGCTCAGCTGGCTTCAGTTGGCGCGATTGGTAGTAGACGACACGATCAAGGCCCTCGTGATCGTGCT
GCATCAACGCACATCCGATTGCGAAGTCGGATGCGTCACACACAACGTGGAACGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCC
CCGCTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGTGGCAGCGGGCGTATCATGACCGCGTAG
TCCTTCACGTACTTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCGGCCACTCATTGATCACTCTGACCTTCT
CAGGGTCAGGGCGGACACCGTTCTTCCCAACGAGACACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATGCACTTCTTCAGGTTCGCATAGAGCTTGTG
CTTGCGCATGAGCGCAAGCGGCTTCCGGAGATGCACCTTGTGCATCTCAACATCGCTCATCCCGTCCGCAGCCCGGCTGTGGACGAACACATCGTCGAAG
TAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGGGTCACGCACCTGTTGAAGGTCGCAGGAGCGTTCTTCAGACCCTGCGGCATCACTAGCCACT
CCCAGAGCATGCCGCTCGGCGTGCTCACTGCCGTGAGAGGGATATCGCTCTCACGCAAGAGGATCTGATAGAACCCATCGCGCAGATCAAGATCACTGTA
GATAGTGCTCCTGGCCATCGAATCGATGATAACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTATACGCATGAACG
ATGCGCCAGCCGCCCTGTGGCTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGATTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTTTCGAAGA
AGTCGTCGATCGCTTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTCGTGCCCGGCACGAGATCAATCTCGTGCTGGATTCCCTT
GTCCTGCGGAAGCTCCGCAGGAATCTCTTCCGGAAGTACGTCCGCGTACTCCCGTAAGATCTCGTAGTAGGGACTCGTTTTCAACGAGTCCCAGCTCTGC
TCTTCAAAGCGCTCCTTCTTCGTCTTCGCACTGAGAGTGTCCTCGCTCTCAGTGGCGGTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTTTTCG
TTCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCAGGACTGGAAGCGAAGTCAACTC
CGACGCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACTGGAACCCGGCACAGGTACGCGTCAAGACGTTCAACGTCTCAACGTCCGGCTTCTCA
GCCTCCGTCTGCCCGGCAGACATTCCTTGTAGCGTCTCGGCCCCGGCCGAGACTTGCGCAGCGACCTTCGCATGCGCCGTCTTCTTGTTTTGCGGAGCCC
GGCTCCGCTTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGGTGTTCTTCTTTAGTACCGCCGGCGGGTTCATCCCGCGGGCGAGCGACTTTAAGC
CCGGCTTGGTCGCCCGGCGCTTCGTCGTGCAGCCGGGCTGCACGACAGCATGCAAGTTTTTCCGGTGCGGGACGTTTGCAACCGTCCGCACCGCCTGCAG
CGTCGGCTCCCGGAGCCGACACGCCATCTTCACCTCGACGCCTGTTATTGGCGGAGCCCTCCATTACGGAGGGTGCGTCGGCTCCCCGAGCCGACGAATC
AAATTCACCCAAGCCATCGACTCCCAGAGTCGACGGCGTTACGTCACCTTGGCTCTTATTATTGGCCAGACCTGATCCAATCAGATTCGCGTCAGCCTCC
ACGGCTGAGGCGTGTGACTCGTCTGCGTCATCCGTGCCCCTTGAGGTCGGAGACTCTTCCTGATTCGCTGAAAAGCGGGTGTCGATCTCCGAGATCAACA
CATTTTCTCCTTCAGCCGTCGGCGGCGACGACGACGCTTGCTGCTCTTGCGCGCGTGCTCGCGCGCGCCCAGGGCGTTCCGGGACAGCGACATTAGGCGC
TGTCTCGAGTGGGGAGTCGCGCGAACCTGTCGGTGCGTGCGTAGCGGCAACAGGGCCATCGCTCACTGTTCCGCTGTCGCGACCAAAGCGCACGAGAGTG
CGCTTCTCCCAATCGATGACCGGATCATGTCGTGCAAGCCACGGCACGCCCAATACAATGTCAAACTTATCGTCCAGATCCAGGACGATAAAGGTCTCGA
CAAACTCTTGATCTTCATAAGTGAAGCGCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCACCCGTTGCCAGTAGTACTTCCAACATACTTCGAGG
TATCTTTAAATCCTCGAAGTCAAGCCTTGATAGACCTCGCAGTCGAACAAAGTTCTTCGACGCGCCAGAATCTACCAAAGCACGGAGAGAGCCGCTTGCT
CTCATCGAGTTCACATTCAGGATGACAAGGTCAGGCCTGTCATCTTGCTTCTTGCAGTGAGAATGAACCTCACTGGGGGCTGCAGTCCTCAGTGTCGCGT
GTCCAAGGTCGACACGCGGAACTGCATTACCAGTAGGGCGCCCCGCGCCTACTGGGTTCCAGCGTTTTTTGTTTGTCCGCGACGATGCCCGGCATCGCCG
CGTCGATCACCATCTCGGTGCACGGGTGTCGTGCACTCTCGGGCATAGTGACCGATCCTTCCGCAACGGAAGCATCGTACATTACTTCTTTGTTGCTGTT
GATAACCAACAGCCGTTGCATTCGAGAGGTCCATTGGTTCCGGACCTCCCGCTATCGCGACCGGAGGCGGTTGCAGCCTCGGCGCATTCGCATGTAGTTT
AGCCTGCCTCAGACTAAACTCCTCCTGCATCGCAAGAGTAATCACAGCTTCGAGAGTACCTGGGTACTCACGGAAGAGATAGGTCTTTACAGGCCCATCT
CTCAGACCCTTCATGAACGTGACGACCTTGGTCGCCTCGTCTATCGGGTTGGTCACAATGTTCGAGACCAAGTACCGTGCTCTCTGCGCGTAAGCATGGA
CATCATGCTTACCCTGCTGTAGGTCGAGGAACTCTGCTCTCGACCGAAACTCATTTTGCGGGGGCTCAAACGCTTGTCTGAGTTCCTCCTTGAAACCCTC
ATACGTGCTGAAGCACGTAGGATCAGAGAGTCGGCGTCCATACGCCCAACTTCTCGCTCGTCCGCCAAGACATGACATGGTGAACACAACCTTGGACAAC
GGGTCGACGATATGTCGAGCCGCGATGGCAGTGTCGAGTTCGACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCGACATAGTTGCTCACGTTTAGCT
TCAACGTTTGCTCGCGCGGTGTCGTCCCCGACGCCACCGTGATAGAGGAAGCAGCATCACGCTGCTTCTTCATGATGAATCCCAGAGCAACACCGTGTTG
CTCCGTCGGCGATAGTGTGCGCAGCATTACAGCTACAGCCGCTTCTCCAATGACTGTTGACATGCCTCCCACTCTGGATCTGACAGGTGGAGGCAGTTAG
CGCGTGCAACATGAGTTGCAGGTGAAGTGGAGCTTTCCATGGGCACCTCCGCGCTCATGAAAAGGTTCTCGGCTCCTCGTTCGTACAGCTCCGTACGAAC
GTTCAGGTAGTCGGTCGTTGGACGGACTACAAAGTGCTATCAGGTGTAGTGGGCCTACCTTGGCTCACTACTACGGCTTACACGTATGCGCACGTGTATG
AGGAAGCGTAGGTTTCTTTTACTTGAGTTAAGTATACTCGAGATCCACGAGTATACTTTAAACAAGATAAAGACTCCAAGTAGCGTGTTTTGGTAAAAGA
TGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAACTAGAAATCTGCCAACGGCTGGTTGGCAGAATTCCAATGCTAT
ACATGTCGCTTATTGGCTAAAAGATGCTGCTTTCAGCCAATAGGAATCCTAAATGTGTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCTTT
GGTGTGTCTACACCAAGGTCGAGGAAGTGTTCAAACCTCTAACAGACATCGCATCTGTTAGAGTAACAAGTGACTGTAGCCACTTGTGCGTGTAACCCCG
TTACACACGAAGCATCGGATGTACTCTTCAAGTGTCCGGTTACTGTGTTCAGTTTGTCCGTCGCCTTGAGCTCGGTAGGCCACTGTCATCTTGAGCTTGA
TATCAGCTTCTCGAAGACTTGACTCCAGAAGCCTGAGATTGGAGTCGCGATCGGAGACGATGTCTTGGGACATGCCGTGAACAGGGTTGTCCCCTCTTGC
CTGAAACGGTCTTCATTGTTGCGAAGAAGTTAGCACGCTTAGTTAACCGATCGAACACGACCTATATAGCGGTATGTCTACGCGTGGTATCTACTAGATT
CGCGATGAAGTCCATGGAGATGGACCACCAGCGCTCAAATAGAATTAGGAGAGGCTCCAGCACACCTGGAGTCTTCGATAGCAGCGGTTTGGCACATGTA
CCGTCTTCACAATGAGCGATGTACTTCTGAATCGTACGCACCATTTGCGGCCAGTGCCAGTTCGCATAGATGCGGTCGGTGCCTGGATGACTCTCGTAGT
TAGGACTATGGAGTTTTTATTTTCAGTAGAAAATCATATATTAGCTGTTAGTTCTTGCCTCTCTGCATACACGAGAGATCGAAGTTGTCAAACGTACCGC
AGATGGGACTTCGAGCTCATTTCACAGCAGTTTTTTTTTCTCAGGTAGAACTTCTAGGTGCGAGCATTCATCCAGGCGTTTCTTGCACAATCTAGGGGTA
TTTCTTGAGCTACCTTGTCCCGATTTAGCCCCCCCCCGGGTTTGTCGTTCAAAAAAGAGAGAATTTAAATGTAATCGAGGGGACTGCTCGAACTGTGGGG
CTTAAAAATAGAGTTCTCGAAAATAAAGTGCGCAATTTTCATTTTACCGCACTCTATAAAACAGAGCGCCGTCTTTTATTTCATATTACATGCTAGTTTT
TTCATCTCTAACACGCCTCCTAAAACGCAGTGGTGAAGCACAGGTGCGTTTCCCGGAACTCATCGTGGCTTTCAGCCGCAATCGCAGACTTTTTGGGAGA
AAATCCATGTCTGTAAGAATGATAAACTTTAAAGTTTGGAAATTTGCAGGTTAGTGTGAAAATCGGTCAGAATGTCCACGAGGATGCGCTCGTAAATCAG
GAATTTGAAGACTCCATGTGCTGGATAAATGAAACTCCAAATAAAATAATAAAGAGTGTAAATGAGGGTTTAACGACATAAATCTGAATGGGATATGCTC
AAGGTAGAGAGCTCTTAATAAGCTTAAGACATGCTCAGCGCCAACCAGTGGTTATTCCGACTTTGGCAGCCATGTACGAGCGTAGCGAGGGAAGTTTTTG
TGATATTCATGCATCTGCTCATTAACAAAATACATGTCCATTGCTCTCGATCTATTAATCCTGATGGCAACGTCCTCCATGTCGTCGGTGGGCTCGGGGG
GGAGGGGGGGGGTTCGTTGAACGGTGGCAAAAACGACTTGGGCGAGCATGAT