Description :
Non Conding Region
Location :
Scaffold_1:119877- 120085
Sequence
208 bases(100 bases per row)
CGATGATGAGTACACCAGATTAGCCTTGACCTGCGTTTTCAGTGCCGCCGTTCTGGATGCGACTGAAAAAAGGATAATGGCGCGTGTATTTAACCGCATC
CAGGCACGCAGTGAACATCGACCCCCGACTTCCGACGGTTCGTTAGGGTATTTAGTCACCTCATAATCCCTTACGGTTCGAACCTCTTGTTTGGTTGTTT
GACCTAGC