Description :
Non Conding Region
Location :
Scaffold_1:119439- 119690
Sequence
251 bases(100 bases per row)
CTCCAAGAGGTGAAGATTTGTCTGCATACGATAAAAACAGAAAAAAGTCGTCTATGTAAACACGATCAATTGAAAAAGCTTAAAGCGATGCAAAACCTAA
CCAATACACGACAGAAAGCTCAGTCTGCGCTGATCTCCTATCGAGTGAAGCGCCATCCTGGCACCATGCGCGTATGCGTCTTCCCACTCGTCTGTAATCG
TTTTCCTGGCCTATACGAAggctgctgcgcttgaagCAGCCGCCATTAAAT