Description :
Non Conding Region
Location :
Scaffold_1:119365- 120099
Sequence
734 bases(100 bases per row)
GACGTCGAGCCGAATGAAAAAAAATGAGCTGGAACTCAACGCCACAGTAAAACACGTGCGAGACGACCCGAGAAAAGAGGAGAAACCGTCCGACCTCCCA
GTTGGCTACAGCGATTTTTTTCTCTGGACAGGACGGGACGGCTACAACTCAAAAGGGTACTGGGGTCGCTGACTACCGTGGCACCTGCAAGGAAGGGTGT
GTGTTGCATCGAACAAGCTGCTGTTCCGAGGGTGTCCAACGACATCACATCGTTTCTTCACCCGTATAGCATGGCCAAGACCCCTCCCTCTCCTCTTCTT
CTTCTCCGTCCACTGACTGGAGCTTGAGCCATGGGTTGACCACCCAGCAGCTCGATCAACGGCGTCTCTGCACGAACCGTTATCGAATGCTATTGAAACG
GTCAAGACGTCAAGCGCGTCACTGACCGCAGGGTAAAAACGAGCCAGAGGTGCAGTTGATGCTGTGCATAGCCAGGGCAGCGTGTGCAAGCGAGCGATCA
TTCACCACGGGCTCCGATGACAACTGGCTCTTCTCTCGTTCCAACTTGAAGCTGAAGCACCGAGGAGGAAATAAAAGAGCCACGACTGGACTTTCCCGGC
CGGATGATGGATGTATGCTGCCGTGCTGCTGGCCTCAACACGATACGACTGGACAAAGGTGGACCACATCATCGAATTGCCGTTAAGTACGATGACGACC
AAACTGCAGCTGGTGTAGCCATTTGACATCAACA