Description :
Non Conding Region
Location :
Scaffold_1:11897- 13972
Sequence
2075 bases(100 bases per row)
AATGCAAGAAAAAGTCAAATATAAAGTGCTTTCACTGTAACCGAAATGTCCACATGAAAAAAGACTGCTGGAAGCTTCGGAACGGCGGTAAGGAAACAAT
GAATGAGCAGGCGTTTCAAGCTACGAGTCAAATGCATGTGGCTGGATTCTGGATAGTGGCACCAGTAGTCACATGTCATTCAAGCACGATGATTTCACTA
ATCTTGAAGCGATCACGACATCTATCAATATTTCAGTTGCGAATGGGGCAAAATTAGAAGTGGTTGGAATAGGCTTAGTTCACATGAAGCTTTCGAATGG
CAGACATATCAGAGTTGAAAATGTGCTGTACGATCTTGATCTGGACAAACGTCCGTATCTATATCATCAATAAATGAGAAGGGCTTGAAAGTCGTGTTTG
GAAGGGAAACATGTGAAAATAAGAATGGGGATGAACACATCATTACACTTCCCCGATCAGGAAGACTATTTATCATCAACGCGCAGATCAACGAACATGT
TTTATTGGGATAGAACAGGAAGATAAAGGTGGTAATACACAAACATGGCATGACAGGCTTGGACATCGTTCGGAATTACAATTAGCTCAGCTGGGGCGAA
GCGTAAAGGGATACGACTTGGACAGAAAAGTGGAAGACTGCATGGAGATACAGGTCTCCCTTGGTTAATGAAATAGCAAATACGCATTACGTTTTGAAGG
TTATTAACTGGCACGAATATTAAGGCAAAAATAGAACATTCCCAATGTTTTGAATGAGATCTTACAGGTCGTCTGGTATAATGCCGGTTTGGTTCCAGCA
ATTCACCATCATGGACTAAGTCACAGCTTTCCACGCATCACGGCACCAATGCGTAGCCTGCAGGACGTCGACTCTGCAGATTTCCTCGGCGCACTTCTCT
TCGTCGTCAATGACACTGTCTGCCACGTTGACAGCATGACATCCATGCATGCGGCGGCAGCACGCCTTGAGACACGAGATGACAGCCGCGTTCCTTGGCT
GCAGGATCAATGTGGTGTTTTACGGTAGTATCTTGATCTCTACGTTTCTGATAACCGTCTAGACGCTACGCATAAGCGTTTTCTAGGAGCGCCAAGGCTT
GACAGGCTTCCTTATACATGCGCCCAATGATTACATCCACCTACTTGCGGAAAAGATTCCACGTCAGCCAGTCTTTTTCGGTGCTCTTGTATTGGACTTC
ATGCTGCTCGGCAGAGTGCCGAGCAAAGCAGCGCGGTTTGACCGTGGATCCCACGAACAGCAACGGGAGCTTCTCTATGCCATCGGCATTTGCCCTCAAA
GCGGTAGTAAAACGTTTCTTTTCGTTCTTCCGCCTTGAGGTTTGTTATATGGAGATGGTTATGGTGTGTGCCTTGTAGTACACTCTGCGACAAGTAATAT
CGTACACCCATGTTTTTGTCTACTGCTCAGTCAATTTTGGGAATTTGCGGATGCTATTTCGTTATGTAATATAGCTCTTTAGTAGAAATAACCTATATGT
GACAGCAATCGCGATTTCGCAAAGTGCAGGGGGTCTCACAAAAAAAAATTTGCCACCGCGACACATTAAATCGTACACCTCAGCCCATAAAAATTTCAAG
TATGATTAATGAACAAACTAAAGACTAGTTGTATTTAATAGTGCGTTTATTGCCCTTCTTTTCGACAACCTCAACGCATCGTCGTGGCATCGAGCGAACA
AGCGACACTAGTGTGTCATGCGGTATTGCATCCCATGCATCAAATAGTGCTGCCTTCAAATCAGAGACGCGCTCAAATCGTTTTCCATTAAAGTACACTT
GCCTGCTCATAATCGACCACAGATTTTTGATGGGGTTGAGTTCAGGTGACTTTGACGGCCAGTCAAGCATCTGAAATCCCTCTTCATTAAAGAACTCCCG
GCTACGATGAGAAACATGTATGCTGGCGTTGTCCTGCTGATAAATGAAGTCGGTGCCGTACTTAAGATGTGTGAAGGGGAGCAGATATTCAGACACTGTG
TATACGTAGTCTTCTGAATTCTACCTCCCGTTCAGCACACCAAGTGGCGACTTACCACGGGCGCTAGAAGCAGCT