Description :
Non Conding Region
Location :
scaffold_1:118908- 119144
Sequence
236 bases(100 bases per row)
GTCGCTGCCTGCCCGGGAGAGTCCTGCGTACGGTCGATTCGGTCTCGAAAGGGGAACCGCACGATCAGCGGTACACTGTACCTCTCGAGGCGACTTAACC
GGTTACACTGAACCGGATCGGCTATGAACAGACACCCGAACCGGTTAAGCTTCAACTTGCTTGTTGCCTTTTTTGCCTGTTGCTATATTTGAGCTATTTG
CTATATCGCTTTATTGCTGGGGGAGTCATAGCGAGA