Description :
Non Conding Region
Location :
Scaffold_1:118746- 119063
Sequence
317 bases(100 bases per row)
CTCAAGTTTTGGCAGAGTTTCCAGCGCAGTcaagtgtagccatttctAAAAATGGGCACCCCAATTGAACATCGTTTTATGTGCACCACATGAATCCCCG
CCACAGTTGATAAACCGCAGCTCCCATACGAAAACTCCGTCAGGCTCGAAAGGTGAGGATGGCGTCACGTCGGCGCCTGCACTCCCCCCCCCTGGCGCTC
GGTCGCTCGAGCAGGCACTTGCACCACATAGTTCTTCGTCTCACCTACCTGCTCATGTCATTTTCTTGCAGAGAACCCCCCTCTATCGTCGTTAAATTTC
AATTTGGGAAAGCACGA