Description :
Non Conding Region
Location :
Scaffold_1:118601- 119022
Sequence
421 bases(100 bases per row)
GAATCAGTACAAAGTGCAGCAAGACGACGGCAGGATGTCGAGAACGACGAACGGTGAAGTGCCCGATGTATAGATCAGCGTAAGTCTGCGTTTGCTACTG
CCATTTGCTGCGATTACGCGCCGTTATTTTGCCTTTTTGTGATGCGAAAGGCGACGATTTTCCCATTTCCAATACGATCACACCACCAGCCCTCGATCGT
CTGCTCTGCTCCGTGCTTGTTCTTTGGTCACGTGTTTACTTTTTGAGTATTTTTGCCCTTGGGATTGTGCATTTGCTCTCTGTTGGTATATTTATGTGGA
TAGATGATTTGCGAGTGTGTCGTATTGCCCATCAAAAGCACACTGGTTAACCCAACACAGTCAGCCAATCAGTCAAATTGCTTGCTTCGCCGAGACCTCC
AAGCAGAACCAAAGAGAAAGA