Description :
Non Conding Region
Location :
Scaffold_1:11860- 12024
Sequence
164 bases(100 bases per row)
CAACTTTTGCTATTTTTAATAGTAGTCCCATGCTACTAGTAGTAGCACCCTCAAAAAGCAATACTTTCCCGTAGTACACCTATAATAGTCTATAATAGTA
GGTCCGTCTACTAGACAATTCGGGCCAGGTTTTTGGCCAATTACACGCTAGGAATTGTGTCATG