Description :
Non Conding Region
Location :
contig_1:118569- 119194
Sequence
625 bases(100 bases per row)
GCAAAAGAGTCGAGACGATCAGAATCGAAAGTGCTATTATAACTACTGCACACCTAGGCGGCCGGTAGAGGACTCCGAGTTTGTACGCCGTGTGTGCCTC
CATAGCAAAGAGAGGTTTTGCATGAGCTGTTACCAGCTGCATTGTTGGCGATCACGTCGTATGAAGGTGCCAAAAGCGTAGGATGTTTTGACCGGCATCC
ATGACGACGACACGCGCGAAGATTCATTGGGAGACCTGGGTCACCAGCAAGTTGCTGCTGGCAGCAACGGAGCAACTATCAAACTGCACTTCAACAAGCT
TGAAGCATTTTTCTGTACGAATCCATTTGCTTTGATGTGTGTTTCAAAAGGAAGACCACGATGTAGAGGTCAGGTCCAACACAAGGATGCTACAGTCTAT
TGCATCAAAAACGAACCGCACAAAGACACAAAGGTGAGCCACGGTCATCACGACGAAGTTATCGCGATGTACGTCTTGAACGATGAGGCTGTTGGTATTG
ACTTAGTTGTTGAAACTGTACGACAGCGACTTTTGCACGGCTACGGTGCCTACAGAAAACAAAATACATGTACATCTACTGGTAGTGTGTATGCGATGCT
TCTTCACTCTAGCGCATCGCCACCT