Description :
Non Conding Region
Location :
Scaffold_1:118543- 120839
Sequence
2296 bases(100 bases per row)
GTTTGCGGTCGTTGAGCTCGGCAACATCCTATCTCAATTCTTCCTATTGCTGAAGACACCCATCTCGATAACCAAGCGCACACGAAGTTTAAAATTCGCA
AGACTGCGCCAGATAGTTCACTCGAAGTTTGACTTCTACCAGGCAACAACGAGGATTTTTAAGAGACGTTCGATTCACAAGTGGAAGCGCAAGTACACGG
ACGATACGAGCCAGTGGAGCGCAGACGCAAGCACTGCAGCAGCTGACGATCATGGCGTTGAAATACTCGACGTTCGCGTCTCTCAACATGGGCCCTCACA
ATCTGTTCCGACGGTACCTTCGAAGCCACTGTGGTACTTGCCGTTATACGAGCTCTCTCGCTCACGCAGACGACTCACTTGCAGGTGAGTCTTTTGGAAT
TGTGCGAAGTGGAGATTGGCTGGGCTGTGCGGTCGCCCTCAAGTTTCTGGACTACGAGGGCGGTTCCGACAAGGTCAGTACCAGACTCTTCTTGCACGAA
GTTCAAGTCTGGTCCCACCTCAAGCACCCTCACATCATCGAGCTCTTCGGGACGTGTCATGTCCGGAAACGCTGCATTGTGTGCACGTACGCCTCGAATG
GTACGCTGAGTCAGTTTTTGGAACTCGAAGAGAACAAGCACCTGGTATGGGAGAAACTCTACGAGACTTCACCTGGGTTGCGCTATCTGCACAGCCGCAA
CATTGTTCACAACGATATGAAATGCGACAACATCCTGGTTGGCGCAGGCCAGACAGCGAAGCTGGCTGATTCTGGCTTAAGCTCAATTCTAGGTGCTGCC
GAAGTGAAGATTACTCCTGATCGCATGGACACTGCAAATTGGAAGGCACCAGAGTACCTCAACGGAGCTCGACTGTCCTTTGCCTCTGACATTTATCCGT
TTGCTATGTGCGTCCTGGAAGCTGAGACTGGCGATATCCCGTGGGCTCGCTATACGCCAGTCGGATCGGCTGTCCACCACCAGAAACGTCGTTTACGTCC
AAAGAGGATGATGGACGAACAGTGGCAGCTAACTGAGAGCTGAACGTGCCGGGAACCGGAGGAACGCGTGAATGCGGCTCACGTCGCGCAGAAACTCTCC
GAGCTTGCTCAGCGTTGACCACGGTTTGTGAGAGGAAAAGAGGAACCACCTTGCGCAATTTATATTATTTAGGTATAGGTTTATCTAACATTGGAGAACC
AATCAGTGCGTTTGATGAACAGGATTGGTAGAAAATAGTATTTTAATACAGTTACTATTTTCTAATTTGATAATTGGTGCGTACTACGAAATAGATGGCT
TCACACCAGTCGTAGACGCGCTTCAACCTGGGTACAACAAGTAAAATATGCAACATCCTGCCACAAATCTCATTTAGGTGGAATTGCTACGGTACTACCG
TGAATCTATCGTCTGTGTGCGGCACATACACTATCAAAAGTTTTGTGGTATGCACTTCGGCGCTTTGTTGGCTCTTGGCAAAGGTTGCTGTAAGGCCAAA
CTTTATAGTCGTGATGTCTACTAGGACATGTGATATCTTCCCGCTTCAACTTGATTGGCCGAAGGCATGACGGCAGCACGAAGTACAACATCCCAGACAC
TCATCTTGCCCTTTGACAGGCAGGCGCGATGACGACAATGGAAGGGTTCATTTTAATAAAGTGACCAGCGACCTGATTGGCACTCAATGGTGGTCCGCCA
TGGGTGGGGCTCTCTCCCATCAAGTGGGGAGATGCGGTTGGTCATGACGCCACGGCAGGAAGCGTTGGCACGTGCCACCGTCGCAATCACGTCACGTCAC
TCGCACCAACGAATTACAGTATTCGAGTCCCATCTGCGACCACCGACGCACATTCATGACGGATTATACAATGCTCCTTTTCCAACCCAATTAATTACGC
ATTCGTATGCTCCCGCCAGATAAGCGCACATGGCGATACGCTATTACGGATCATCATAACACTCATTCCACATGCAGAGGCAGACAACAGCATCAGCTAC
TGAAATGCTACGGCTTCCCCCTGCTTCAGTAGATGGCTTACAATTTACATGGGGATTTCGACTCAGCTTGAAGAAAGTCGTTGCGCAAAGACGTGCATCT
GGTTATGACCAATACAGTGTCCTTAAGGACATGAGTATCGGCCTCTGATTGGCCAAAGGCATAAGCAAAGAAAGAATAACGAATATGGGAGCACATGTGC
ATCATAAAGCGTTTGGCAGCCCATTTCGCCGTTGTCGTCACTTTGGATCTTGCTGCGTGAGCGCCACGACGACGACGACAAGCACCATGAGCGCTA