Description :
Non Conding Region
Location :
contig_1:118459- 120594
Sequence
2135 bases(100 bases per row)
GTCGCTGCCTGCCCGGGAGAGTCCTGCGTACGGTCGATTCGGTCTCGAAAGGGGAACCGCACGATCAGCGGTACACTGTACCTCTCGAGGCGACTTAACC
GGTTACACTGAACCGGATCGGCTATGAACAGACACCCGAACCGGTTAAGCTTCAACTTGCTTGTTGCCTTTTTTGCCTGTTGCTATATTTGAGCTATTTG
CTATATCGCTTTATTGCTGGGGAGTCATAGCGAGATGACGCCGACTAGGAGGAAGGAGAAAAAGACCCAGCGCAGAGAGAAGGAAGACGCCGCTCGACAG
TTGACAAGTTTGCTGTCTACAGAGAGCGACAAGTTGAGCGAGCAGCTGCTGATTGCGAGCGAGAAGGGCAGGCAGCGCGCTGTGTTCCTGCTGCTGCATC
AAGGAGTGGACAAGGACCGATGCAGAGGCCTCGTACGTGGCTGCCAATTGAGAAGAAGGACGAAGGTTGTGAGCTGACTAATTCGTGTTGCATGTTGCAG
CTCGGCTGCTCTCCGGTGCATCATGCCGCGGCACGAGGTCATTTGGACGTGCTGCAGCTGTTGCTCGACTTTGGGTGGGGTGTGGACGTTCGCAACGACG
CGCTAGAGACGCCTCTGCATCTCGCGTGCTTCGACGGCCACGTGCACGTTGCAGAGCTCTTGCTAGACCGGGGAGCGGATGTCAACGCGAGAACGAGCGA
TCGAGAGACCCCGTTGTTTTACGCGACTAGGAAGGGCCAATACAGAACGGTTCGACTGCTTGTCAGACGGGAGTGCGATCTTGCAGCGGAAAACTGCTAC
GGCGACGTGGCGGAAGAAGAAGCTCGAGATGCAAAAACTCAAGCTGAATTTGCGTCTGGAATCGAAGACTTGCAGCGAACGTCAGCAGTAGAGGGCCAGC
GTGGAAACAGCGGAGAGTATACGCTACCACAAAAACTTCGAGAGCGAGTACTGTCATTTTTAGATCTGAAAAGTCTCGGGTTTGCTTCACAAGTGTCGTA
TCGATGGCATCGAGCTTCGGATAATTCCTCGTTGTGGAAGAAACTCGGCGTATCACGGTGGGGATTGCTGCTTAATGCGGCGATGGGAATGGGCACGGTT
CCTCAGATGTCGATGCTACGTACTGCTACGAGCAATCTCTTACGCTTGAATCTCTCGACAACGGTGTCTCGGCGTCCATCGAGCTGTGATCAAGTTTTTC
CCGGCCGATTCATGCCGTTGAGTGCCAAGGAAAAAGATCGGCCGCGATATCAAGAAGAAAAGCGACCTCAAACAGCTAACCTTGCAGGAATTTAGACAAG
ATTTTCCATCAATGCTGCATCAATCGTGATTTCTCTCAACCTGAAGAACTTCTACGGTCATAATCTGTTAGTCAAAGGCATTTATCTTCCAGATGCTTGC
AACAGTGAGGATGCTACTCCTGTTGTTGTCGATGTGCGTAAATTGGAAGTGGCGATAAGCATCCAGCAAAAAAGACAACGACCGCGATGGGGTTACCTTC
GCTGCACCCCTAGCATTCATGTAGTTGCCCTTGCTCAGCTTTGTCGGGGGTATACAGTGTGAGCTTTCATCCTCGCTCTGATCATTGCAAGGGTTTTTGC
GTCTGCCAACCTGGGCATCGCTATTTCACCAGGCTGCGGGCTGGGCTGATCGTTGCCGGATGCTGTTTTTTCGTACCATCAGCCACGAAAGCGTGTTTCG
TACGGAGTTGGACAAGTTCTTCTGCAACCAACGCATCAACGAGGTCAGCACTCAAGAAGGTAACCTCGACAAGCTTCAGGAAATATTTGGTACGACTTCA
CCAAACGCGCCGCCGAGGTTCGACCCGATAGAACGTGTGGGAATATATGCCCCTTTATTAAAGAGGTGACCTCGATCTCATTTTCCGAACACGTTCTTGG
ACTCCTGCAATACCACGGATAAAGTAGACAAGTGGTGCGGACACCGGACTATGGGACTTCCTACAAACACATCTTCGCTGCTGACTCCATTCTCAGTGAA
CCCGGGAAAGTATCGCTCATTTCAGAGACAAGAGCGTGAAAGTGAATTCGATTGGTTGGATTGGTCGTAGCATGGCTACTACCTCCAGCAAAATCGCCGC
AGTAGCATGCGTGAAGCTGTACAAGTCGAGCCATT