Description :
Non Conding Region
Location :
Scaffold_1:118393- 119338
Sequence
945 bases(100 bases per row)
AATCGTCAAGTGCAAAGTCGGGAGCTTCGATTTGCAGCCGTTCATTCCCTTAAACAAGTACAGTCGGGGGCCACGACTCAACGGCTCTCTGGTACCTCGA
CGCGCGCGCCATGCACGCCATGGTGAACACTGATGCCAGTACGCTTACTAGTGCGCTAGGACAGCGTGCGCTGGTGTGACGGTCGCGATGCGCTTGAGAG
CCACATGCCATAGGCAAACCATGCTCGAGCCAAATAATGCTTGGCAGCATTCCAACCTGTACTTGGATAAGCGAATGGGTGGTTGTCGTATCCGGACGCT
TCAACCCCGTGCGGCCGCCATCCTTCGAGTATCACGTCCGTCGGCCAACTCTCTTCTCGAAAAGCCCTGGGGCAATGCGAGGCATCTCAGCTGGAGACAT
GGTCGAGTGATGGTGCTGACGTTGCGCGCTTCCGCTGGGTTCGGTTCTGGCCGGCCTTTCTTTTGTCGCAGAATCCAGTTGGTAGACTATGACGTCGTAA
CGAATGCGATAATTATATAATAGGCTGTACAATATTGTCATGCACTTGTAGTCGTGCAAAATAGCCTACGAGAGCATAGGAAGCTTAGGCGAGGTTTGCA
AGTCGAGAAGGCGAAAGGCACCGCTGATTGGATAAAAATGAGCCAATGCTTGCTTGCGATTGGCTGAATATACCGGTCGGGGCCAGCACAGGATTGGCTT
GAAGCCAATATGACGTGGCAGCGCTGCGTAGCGAATGGACTGCGTTTCGATGCAGATGGCCGGCACACTGCTGTCAAGGGTCCCCACCACGACTAGAGGG
ACGTATCACAGTCATACAGTACCATATACTAAAGAGACACGCAGGACGACTTGAGCAATGGGGTCCCGTTGGTTGGTGCATCGAGCCTGTACCTTTCTTC
TGCGTGCGCACGGCCTGTGCTGGGCATTTGCCATACAAAGGTAAT