Description :
Non Conding Region
Location :
Scaffold_1:118347- 118564
Sequence
217 bases(100 bases per row)
TGAGCTGCAGGTTGGCACGCCACGAGCACATTAAAGCCTTAGACAATGAACATGACATGtacagcaagttgcagttTGTCAAAATCGTTCAAAACCAGCT
ATTTCATCTTTGTCGGGGTATACTATCTGAAAAACTGTGGCCAAAACATTTTAACTTCCGCGGTACTACGGATAAATTTCATTTCTAGAGTAGAAAATTT
CGATCGTCCAGTGGCGA