Description :
Non Conding Region
Location :
scaffold_1:118147- 118300
Sequence
153 bases(100 bases per row)
CTGCAATCTCTCCTTCCAAAAACAAACAAACAAAAGCACCCCACACTCCACTCAAAACACCACCTTTTACCCGTTCTTTCTTGAATTGGTTCTCGTTGAA
ATTGCAGCAACGATCTCATCTCTGCACCTGCCGTCAATGCAACCGGGACAGTT