Description :
Non Conding Region
Location :
Scaffold_1:11804- 12710
Sequence
906 bases(100 bases per row)
TCTGATGTGTCTGCTGGATGTTCCGCCATTGTGGATTTTGCACCAATCAAAGAGAATGAGCTATCTGATTTGTTTTTAGTAAGGATCGATTCGGCATAGG
AAGCTGCGAGGAGAAAATATGACAGCGAGTCCAGGAGGGCATCATCTACACTTGTATCTTGGCTGCACAACAGTAGTGAAGTTACTACGTGTACTTTGCT
GAACGGCAACAATTGGTATGTACGTACGAGTCGGACACGACGCTTGCAGCATTATAAACGACAAAACCATGTACTGTACCGAGTTACCGGTACCGTGCCA
ATAACAGCTGGCTTTATGGTCCCACTCGTCCACCGAACATGTCGGCTCTCCGATACAAATTGGACGACAGACTTCTTCATTCTTGCGTGAGCACTTTAAG
CTTCCGACATGCTTTCCTCAGCGATGGAACGCCATGTACATACCATTGTATGCGCGTACGCAACCTGCCCTGTGAGCTCTACGACTTGTGGCGTTCTTAT
ACGAATCTTTTGGTAAACACGTTGAATGAAGACACATGTCACTGCTCGCTCGCGATTGGCGCAATGATTTATATCCAATCGGCGTCGACTGCCTCGTCTG
CTAGACAGCCAGCAAACTCCGCAACACAGGCAAGTCACACTGTAGCGAACCTTGAAAGCGATTTTCCTGCATACAAAGGCGGTCGGTCAACCAATCAACT
GAACAACGCGTCGCTTTCAGAAGGAAGAAACACAGGACAAGGAAGAGCGCACACGTCGCACACGTCGCGTGTTCTCTCGGTCTTCTCAGACAGCTACCAA
CCGCAACACTCAGACTCCCAGACGACCGCTCACTCAGCTATCTACCCGAGCTTTTTACTCCCGAAACAGCCCAGTAGAGCACCAGAAAAACAGGTTCAAC
CGGCCA