Description :
Non Conding Region
Location :
scaffold_1:118030- 118533
Sequence
503 bases(100 bases per row)
AACGTCGAGCCAAATCTAGCACCTCAAGAGCGAGAGCTACCCCATCCTGCCAATATTTAACTACCAACTACGACCAGCTGAAAATCAGCTACATCCGTCC
AGTGTCAAGCGTCAAATGCGACGTCCTTCCAGACCACACAGATCACCAACCACCGGACTTCCCTGACCTCTGCTTTTCCGACGGACAGAAGAGCACGAAA
GGGGAGGAGAAGGCCAGCCAGAGGTGGTATATTATGCATGTTACCGTATCCGTAATAACAGTCCTCAGTCCAATAAATGTACAAGTGCGACCGACACCTT
GCACTTCATTGATGCGTGCATGTGGATGCAATTTGGATTGTACTGCAGCTGCACGAACGTACGGAACATGGTTGATATGTTTATTATGGATCTTTCCTAG
CTTCCCGGATAACGTACTACTACTAATGGGGATAACACGAAGCGCCGAGGCGACAGCACGCTAACTGCGGGTTCGTGTTGGCTGTCGCGGCGTCTCTTCT
ACT