Description :
Non Conding Region
Location :
Scaffold_1:117916- 118064
Sequence
148 bases(100 bases per row)
CCAAATGCACAGCCATATTCACATTCTTCTATTTTTACGCGCAAAACCGCTCAAGCTTTTTCCAAGAATCGTCAGTGTGGAGCTTCTTTGTCAGATCTCA
GCACTATGCATTGGAGCTTTGTCAATCGCTTTAGGAAGAGAGGAATTT