Description :
Non Conding Region
Location :
Scaffold_1:117762- 118265
Sequence
503 bases(100 bases per row)
CTTGCAGCAATGCATAGAATACGCAAACGCATGTATCGTTTTATCGAATTATATAAAAaGAGAGGTATTCGGAGCTGGGgAGGgCGCTTGACTTGGCTTT
tGTATGGACCGCATTCGGAGTAGGTTTCGAAGCGCGGCCAAGTGAAACGACTAGTACTCGGGCATTTCCTCAATTGAATTTTGTGTTCGTTGAGCCGAGA
GACGGTTAGCATCTCCCTCGACAAGGACGGGATTGCGCGTATGCGTATCCAACCAGTGGATGGTTTAAGCTCTGTTAAGGGGATCTCCCTGACATCTAAC
CAGTTTTTTTTtGTTtCATATTTCCCCCcTCTAGAATTCTCCCTTCTTTTTTCCAATTTCAATTGAAAAAAaTCGACCGCCGCTGGTCTCAGATCTGAGT
ATCCCGTTAGAAACGCGTTGCTATCGAGGCTGGCATGGGTCGTTATCTGCGACTTGATTGACTGGGCACCAGGTGGCAAGTGATCACGAGCTAGAGGACG
AGA