Description :
Non Conding Region
Location :
contig_1:117698- 117851
Sequence
153 bases(100 bases per row)
CTGCAATCTCTCCTTCCAAAAACAAACAAACAAAAGCACCCCACACTCCACTCAAAACACCACCTTTTACCCGTTCTTTCTTGAATTGGTTCTCGTTGAA
ATTGCAGCAACGATCTCATCTCTGCACCTGCCGTCAATGCAACCGGGACAGTT