Description :
Non Conding Region
Location :
Scaffold_1:117659- 117955
Sequence
296 bases(100 bases per row)
aagacgttcatggcctcaacttttccggtagtgcggggagacggacaattgagagcctctcgtagctgtatttaaaaaataggaactatttagtgtggaa
tacccaaactaccgttttaaaaataattatttttgaaggttcatttcattggccataagctcattagcaaattgtagcaggaagatggtggccaatgcgt
tcgtactgtgcaaggtgcggcacagtgtgagtctgtcgccatgccatgctatggagccgcgagtgggcattgagcagaacttgacggagcagctta