Description :
Non Conding Region
Location :
Scaffold_1:117639- 120250
Sequence
2611 bases(100 bases per row)
ATTCACGCGAAATGTCGAAAAAATGTTTCCTCGTAAGGATTCGATAAAGTTTCCCCTTACACGTCAAGTGGTGAATGGTTTGGTCGATGCTTGTCGCCAG
CGTGGCGAGTGGGATGGAGCTGAATATGCGCTTACCCTTGTCGAGAGGGTCGACGAGGAAGGTGGTGCTACTTCAGAGGTCCAAAAGCAAGACACAGCGA
AGCTACAGCAGTTAGTTGTGCAGCGAGATGCTATGTCTGCGTCAGTGGTCTGGGCACTGGATGAGCAGAACATGTCCCGGATGTCACGACCTGAACAAGA
AGCATTTTATCGGAGTCGAAGCCAGAACGAAAGTTTCGAGCGCGCTTTTGAGCAACTGCATGTGCGCAACGCCTCTTCCAACAGAGATAGCTCTATTCAG
AAGCTTTCCTTAAAATTGAAAAGCAAGCTACTTGTTTTGGATGAGATGATTCACGCAAGGACCGCAAGTGTAACAGAATTTAATGCAATGTTGGGCGCTT
GCGGACGACGAGGCCAGCTGAGGGATGCGGCGTCGGTGCTCAGAAAAATGAAGCAATACGCAGAATCTTTTCCAGAGTGTGCACCAACGACATGGAGCTA
CAACGCATTGCTAAATGCTTGCGCGGTGCATGGCGATATCTGCCAAATCGAAACAATTGTGAACGAGATGATTCAAAACGACCTATATCCTGATCAGGTG
ACCATGAATACAGTGCTTAAAGCGCACATTAACAATTTGAAGGGTGGTGCTGGTGGAGGTCCACAGATACGACTTAACACGGTGATGCAGGCGCTTTCGT
TCTTTGAGTGGTGCACTGAGAACCAAAAGCTCAATTCGGGAGCAGCGACGTATTATTCGCTATTCCGTTTGTTTGCTATCTATTTGGAAAGGCCAGACGA
TGATAGCAGCAACGCCGATAACTATGTCCAGGAGGAAGATGAAATGTTCAATGAAGATCAAGAGGGAGAACTCATGATGTGGATGACAGAGTTCATAACC
ACCACATGCCGCGACGCACCGTTGGCGTCACTGGACATCGGAGTGTTCAACAATGCATTTGACTATTATCAGCGACTTGGAGACGTGGACGAATCGTTTG
CACTATTTAATACGATGAAGGAGCGTGGATTTCAGCCGGACGATACTAGTCTGGGACTCATGTTTGCCACCTGCGCGAGCCAGCAGCAATTTGAGGTTGG
GTTAAACTTTTTGGACCATATAATGGCTGCAGATGACTTTAAGCCTACTCTGAAAGTACTCAGCGGAGCGATGCAATTGTGTGCCAACTCAATGAACCCA
GATGGAGCGCTAGAGCTCTTTCGAGCGATCGAAATGTCTGGCACATTTAAGCCTACAATAGAAACCTACGAGCCGTTGGTGTACGCGTATGCTCGCGTCG
GGAACGTGTCCGGTGCTTGGGAGATCGCGAATGAGATGGAGGAAAAACTTGGGAGAGTCTCGCTCAGTATCTACAATCGCATTCTTTTGGCATGTGTTGA
AGCTGCACTTCCCGGACGCGCCCTGGAAGTGCTAGGTGTTGCACGACATAAAGGCGGTGTGGTCCCCGATGTTATTTCATATAACACGGCACTGGAAGCT
TTCGTTAGAGCTGGGGAGCGTGCTGCTTGGTGGAGAAAGAATAGGATCAACTGGGAAGAAGATTCAGACTTCGATGGTGAAGAACCTGATGAAGTTGAAA
ACCATGGCAACGATTATTATGCTGACCTTGAAGCAGTTGAAGGTGACGATCTTTTGAGAGAGGAAGGGTTTGACGAAGATGCCGTACGCATCACTGAAGA
CCTTACTGTAGACGCAGTGTCCCAACGAAATGATGAAGCTGAACAGCGCGAAAAAGCTGCATGGGTTCGCGCTAGCGTTATCGACCTTCTCGATGAAATG
CAACGAAGCCGAGTAAAACCTGATGTAACTACGTACGAGCGCGCAATAGCTGCGTGCAGTGTGAACCAGGACCCCGAAGGTGTGATTTCTCTATTCGACA
GACTGATCGAACACAAGCATGGAAACAGCACTTCCATGCTGAAAAATGATCTTGTGAGTGACTCCAGTTTTTCGGCCTACCTCGAGGCGGCTTCGTCTAT
GCAGGACAAAAAACGAGTGATTAACGCACCAACACTTCTTCGCAAATGGCACACCGCAACAGGTCAACTTCCACCGGTATTTCTTGTGATGCAGTTGTTG
GACTCCCTCGAAAGTGTTGGTGAATGGCGTCGAGCTGTTCGGATGCTCGCCGATATGCAGTCACTGTTTGGTATCCCACCCAGTGTTGCTGTGTTTAATC
GAGTCATGCAGATGTGCAACTGCGCAGGAGAGTACCAGCTTGTGGCTCCAATATTTGCTACTATGCAGGATGCCACAGCCTACCGCATTTACCCTGATGC
AGAAAGCTATGTTCAACGGATTTACGCTGAAGAGCAGCGGGAGAACTGGGTGGCAGCGACAGACTTATTCGTAGAGATGCAAAAGATTTGTCCAAGTGAG
GAAATTACACATCAACATCTCCAGAAGATCGCCTTAGGCCGGTACAGCGTGCGCCAGAATGAGCATTAACGTTAATGACAGCGTCATTTTACAGCTATCG
CAATCCATACT