Description :
Non Conding Region
Location :
Scaffold_1:117509- 119235
Sequence
1726 bases(100 bases per row)
CGTTTCAATAATAATTGGCGATCGGAGAGCTCAGCTAGCGCTAGCACTGCGAAGTCTTGTTGTAGTTCGCTCCAACGACTGCAGTTCGTTTTGCACGCGT
GCATTGGTACTTGGTTAGAGGGTGTTTACGGATGGGAGGCTGTGCGTGCACGGCGAACGCGTACGGTATTATTGCTCGCGGCGAGAATCTCCGCGTCGAG
AGCCGGCAGTGATATCAAATCGCCACGAACGAGGTGCTGCACAGGCGTCAATTGCTGCTTGCCGGCGAGCCATTCGCTCGCTGCAGTTGCCGTTGCGTTG
AAGCTCCTGCATCTTCAACCGCACCGCGTGTCTACGGCACCCTTCAACTCGACCTGGATCAGTCAGAGATCAAACGACTGGAGCAGGTTGCTCAGAGCAG
CGCCTTCCTCCGTGACTGTGTTTCTTGTTCGAACGGAGCGAAGCAGGCGATCGCTTCGTCCAGCGAGGTTGAGTCATGGTCAAGTTTTTCGCAGGGCCAA
CGAAGTCAATGCCGATGCTAAGATGGAGACCCACCGCGACGGTGGTTTTTGCACCTGCCAGTCCTTCAATGCTAGTGACACATTTCAATTGACATCGCAC
CACGGCACTGGATACATATTTTGTGAACTTACAGGTGAGAACACCATTTGTCGGAACACGTGACCCACATCTTAACGCCTCCGATCAACCATTTGCGGGA
GGGAGTGTTTCGCTTCCTGAAAACCAACCAGTCTCTCTTGACGGAAGACGCACGTACTCATTTGTCTCAGTCACCACAGACTAAAGAGACTTCACTCGCT
GTTGACCAACTCCGTTTTGGATGGTCCACCCTCACCGCGTTATCAGTTATTCCGACAGTGCGCCGCTGCATGGACACGCAGCGTCCGTCTTGACTCAATC
AATTAGTCCGCGCCATTTATATTACTGTGATGCATCCGCGATGTTTGCGATGTTTGCCTTCCTCGTGCGCGCATGTAGCCCTCGGAATGTACACATGTTG
CTGCACTACCTTCATAAGAATCCCATCAGGTTGGCTACGAATTGGTTTATGTATGTTACACGTGGACTTGAAGAGCACGCTGGCACAGACGCAGCGAGCG
CACCAGTTTTCAAACATCGCGCTTCAGGGAATCTGCATTCTCACCGTGCGAAAATATGGCAAACACGCTACCAGTAGATGGTTACCTGATCATCAGGTTT
TGAAGATTGCAGTATTGCTACATCTTGGCTGCAAAACTGCAGCGTAGGAGAGTAAAAACATCGTACCTACACACGCACGCAGCCGCCGTTCAGATCGCCC
ATGTGGCCAACATAGCGAATGCTACCTCATAAGCAACTCAAATGTTACGTTATGTTTTCTCCGAGATCAACCTTTCATTTTCTCACTCCTGAGTACATTA
ATAACTTGTAGCGCGGATACAGTGTTCCATCTACAGTGCGTGTAGCACCCCCGGTAGGCAAGCGGCGTTTACTCAGTCTACTAAAGCCCGCAGCGATGAA
AACATCTTGTTGAGCTAAAAATATTGTGTAAATATTTTGGCAATTTTGGGCTCCACAAAACCACATTCTTTGCACACGAACTGAAAACGCAATTGCGATA
ATTTGCATGATGACCAATTTTCGCTCGACGTCACTCGAGCACAGCAGACTTGAAGACCTCAAGCTTCTTTAGATCACATAGGTACATGTACATGTAACAA
GCAACGAGCAAGGTGCTGCATGGAAT