Description :
Non Conding Region
Location :
scaffold_1:117343- 118265
Sequence
922 bases(100 bases per row)
CTGCTGATAGACTCGGACACTAGGCGTTTGCTGGCCCTAGAACCTCGATCGAAAATGACAAACGCCGTTTCTCGTGAAAACTTCCTTCATTTGACAATGC
AATATCGAAAAGTGTGTGTATTTTGTTTTGCAAAAAAATAGAACAAAACTTGTCGGAACACGTATGTTTGTCAACTGAAGGAAGTCGTAGTCAAAACTTC
ATTTTACAAAGGATACACTATCGAGCAATGGGCCGCTTTACGTCGATGCAGAGTTTCAGCGATCAGGACGCCCAAGGCGCCGCCGTGACTTACGATGCGC
CGTCGAAGGCTGCAGAGTCTTCTGCAGCAACTAGTGCTAACGCTAAGGATGACAAATTCCACGTAAACCGCGTGGACAACGTGTCCGGTAGCTCTGCAGG
TGCCGGTAGTGGCGACTTCCATACGTATCGCGCTTCCAGGAGACGGTATGTCCACGACAGTATTTTGTCAAATATTGCAATTGTAAAATAATATTTTCTG
ACCCATGCTGGCTAGAGAGATGGAGCGCGTGGCGGCCATGGAGCAACGCTACAAGGATAATAAGGCTCAACAGGAGTTTGAGGCCAACCGCAAGCGCAAA
GCTGAGGAATTTAAGGCAAATATGCAGAAACGAGCGGATAAACGGCGACGACGCAAGGATCGAGCCAAAGCAAAGGCTCTGGATGAAGTACAAGAAGAGA
AAAAGGAGAAGGAAGAGCAGGAACAGGTACCTGAGACGCCTGGAGGCGTCCCGGAGATTCCCAATGACGGCAGCTTCTTGGAGAGGATGTTGGCTCTGCA
GAAGCAACAGAGTGAAGAGAAATGAGAGTTTGGGCCAGGTTTGGTTTGATGTTGATGTCTTTGCTGCATGCATCTCTCTTTCTGTTGCTAACAATGATAA
CTACAGAGCGGTTGACAGGTAC