Description :
Non Conding Region
Location :
scaffold_1:117173- 117445
Sequence
272 bases(100 bases per row)
GTCTCCAATACAAAAAGTTGGTTTTGGTCCAATCATGCAATGTGAATGACGTACCCTGTTGCAAGTCGAATGTCTAACATTAAGTTTACCACCGTAAAAG
GAACCCATGAGCTCGTGCAGATAAGGTCGTGCACTGGTAATGGTGCCGCTAAAAATGCAAGCAGAGCTCAAAGCGTGACTAGCAATGGATATTTCTGTCG
AGGTGAAGAGGGCATTTGAGATCTGAACGAGTTCCGCACAAGCGAATAGCTTTGTCCGCAACAGTGAAAGCA