Description :
Non Conding Region
Location :
Scaffold_1:117078- 119103
Sequence
2025 bases(100 bases per row)
CAAGTGCGAGTTGAGCGCTTCGATGATAGAAACTAGAACCTTCTCCGGCCAACAGACTGTCAAGTTGGTGTGTTCATTGCGGTTTGTCAATCCCGAAAGT
GTCATATCACCTAGTAATTGGTAAGTCGCGCTTCAGTTCCACCTTTCAATTGCTAACCATACAAAGCCTCATTTCATATTATCACGGGCTACTTCCGTTT
GTGTATTTAGGTGGCTGTGCTTCTACGTGCGTATTAACCAGCGTGCAGTGACGACGTACTCATTTCCTATGAAGGATGTTTTCGTGCGTGAAGAGCAGAG
CGTCATTCTGAACCCGGACACAGTCGCTGCACAAGATCAGGGTTCTCTGTGGGTATCGTGCTCATTGGTGTTTTGTCCCCCAGAAAGCGGACAGCGAAAG
ACCAAGCGTAACAATACGAGCACTCTAGACTTGAAGACGGCCCAGCGCAACAGCCCGTTGTCATTTGCGATTCCGTTGCTTCAAAGCCGGAGGTTCGTGC
TTGCGCAGCTGAGTCGGCCCATTGAAGGCGATATTCCAGTCAGTCAAGTTGCCATCAACGCTGCTTTCCGTCAAAATCAAGATCCATTCATGCCAGTTAA
TAGGGCAGACAGCTCAAGCAAAACAGACAAAGCCTCATCGTCTGCACTTTGGGGCGGTGTCCAGTGGTGGGCTGCGCTGGCTGACTATGCCCAAAGCAAC
CCGTCGTTTGCAGCTTTGTGGTCGAAAGTTGCGCCTCCAGAGGCGACGACTTTAGCGCTGTCCCCACCTTCGCGATTTGTGATATCTATCTCTTCGTTTT
TTACTGGTGAAGGCGATGATGAGGATGGTGAGGATGAAGATGAAGATTTTGAAAAAGTTCGTGTCGAACGGATGGTGTCTTTCTTACGGCAGCTCTTGGA
TATGCCTGTGAATGAGATTCCACGTTTACGTCGTAACTGCAGAACCCAGCATGGAAAGCTTTGGACAGTGTTGCGAACCTTTTCAGGGAGTCTGATACTG
CTGCGTTTTACGCCATCGGAAGACCAGTCACACTCAGTTGATCTTACTATCCAATGCTCTGATGTGGCTGACCTCTCAGCAGTACGTATTCCCATGTGGT
AGAAGTTTCAAAACCAGGTAAGCTGTGAAACTAATAGCTATTGTACCATGATACTGTGCAGATGCGAGCTCTTGTGCTGGAAGCTATCAGCAAATGGAGC
GATGGAACCTCACGAACTGTTAATGAAGAAGACCGCTCTCAAGAACTCGCATTGGACATTGGCGAAATGCTAGAGCCCATAGCCGCTCTTGAAAGTCTTT
TGGAGGTCTGTTGACCAATGCACGATATAGTTGTGTCGCAGATTTGTTAACCTTGCGCGTTTGTGAACTCGTTTTGCAGGATCTGGCGCAAAAGACGATC
AAAAGTATAGAAGACCCTCAGTCCTCTGTTTGCACTGATGAAGTACTCCAGGCGCTTTCACAGCTTGCGCACCTGGAAACTCAAACGCTTACACTCTACT
GGAAGACTCGGATGCGTCTTAACCGGACCATAATGTAGTCCGTGGTCGCGCTCATGTTGTTAAAAAACTAGAACGACAACTTCATTTTAAAAGAGGTAAA
CCGCAGATAAATCAACGATGGAGATAAGTAGCCACGTCACCAACGGAAAGTACCAAGCTACCTCAAAGCACTTTCGACTGATGACTTGCTAAAGCTCTTC
AGTGGGGAGATGCTGGTCACGCAAGGATGCCTTCTCGGATGGCGACGAAACAGAGTAGAGGCGCTACATACAGACCATTTTCACAATAGTTAGCAACTCA
ACACTGTCGCTAGATATTGTACTTAGAAGTACTTCGAAGTAGCGGGGTGCTCGGGTCGGCCACAGCGTGTAAATCAGAGCCAGATAGATAAAGCAATGGA
CTGAGGTTGTCATGATTGCCACAGTTTTCTCACGCACCCACGGCGACAAGAATGATGCGATAAGCACGATGATAGGCAAGGCTACGAAAAAGACCGAGAA
TAAGCAGCACATCTGAAGCAGGGAT