Description :
Non Conding Region
Location :
Scaffold_1:116924- 117276
Sequence
352 bases(100 bases per row)
TGAATGGCGGCGTCCAGCGGCTGCTTGGGCCGCTCGACCGNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAACTCGCGGAGCACCACCGTTTGCGCCATTG
CTCTCTGATGTCGCTTGGTGATGAATGAATGAATGTGCTCTGTGAGGTTTGCCATGACCAATGAGTGGATTGGGTGGACCGTTTTTGCACGGAGTTGGTG
TCCAAATTGGTAGAAACCGCGGATGCGTGTCGAAAACCCTTTTTCCGACAGTTTCGTGGGATCTCGCTCGCGAATTTCGACGCAGTTCCTTTTTGCCGAT
CCTTTGGCTCAAAGACAGAAGCAAAGCAAAGAAGCAATCAAGGAGGAAGACA