Description :
Non Conding Region
Location :
Scaffold_1:116756- 119606
Sequence
2850 bases(100 bases per row)
CAAATGAAAAATGGGTGCTGGGTATCTCAACGTGACGGCGATTGGCTGATTTTATGGAATTGGGGCGCTAGGATTGGCTGAAATACAACCGAGCGACGAT
GGCACAGCCGCAGACCATCGGCCGTGCGCCTCAGCGCGAGCAAGTGTCGAGGCTGGCGCTGCTCGTATCGACCGGCGCTGGCGACGTCGACTGCGCATTG
CTGATGAGCGCTGAGACGTAGCGCGCTGCCATGTCGACGCACCACCGACCCAGACGGCCACTGCAACACGACAGCTAGTCGTATGCTGCAGCTGCGTAGA
CACTACTCGACGGAGCGAGCGGTCTCAAGTTGGTGCGAGCTCTCAGCCTACATGTTTAGCGCAGTCTATCGAAGGAGCTTCTCGAATTGTGCACCGGCGA
CTGCCGACTGCAACCCGTCGACCACCAAAAACGACGGAGCGATAGGCTCCACCCAGTAGCCGCACCTCAACGACGGCGCCTCACCGTTGCCATCAGACGC
GAGGCGCACTCTTTGAGGTGCGGCTTCAAGGCAGTGCTTCTATCGCTCCGTCGTGCTCGATTCGGTTGGTCGTCGCCGGGTTGCAGTCGGACGATGGCGC
AACAAACGTCGGTCACTACCAAAGTCTACGATAGAATTGGTGACCAAGTCGGTCAAGAAGGTAGACGAGGCGTACGAAGGACAATCAGTTGGTTTCGTAC
TGCCGTCCATTTCCGCATTTCCGTGTCGTCAGCATCTGCAAGATGAGCGCGTCGCGCTGCCACGTTTTAAGCATGTATTTGTATGGCATAACCAAAGAGA
GATAAATAAGAACGATCAATCAGATCTGCAAGAAACTCTCTCACTGCAACGCTGGTCACTCCTTGTACATAGGAGCGAACTGCAACATTGAGGCTGAACC
GCGGGAAACAAGCGGCACGAGGCTTTGTGGCTGCGGCTGAGAGCAGGTCGCCCACGCCAGCGCCGAGGGCCAATGCCACCGCCAAGCCATATTTATCGAC
TCTATCGGAACGAGCTATCGGTACATTGGGCCGAGAAGGATCGGGCGACGAAGTGGCTACGTGACGAGATGCGTCGTCGGTGGATGGAAACCGCCTTTGC
GTAGGTGGAAGTTGCCATTCGCCACACCACACGGCCGTTGATTCGATCCATTCGGCCGCAAAAGGACACTGCTCAAGCGAAAGACAACAGCATTCTGTAC
GGTCACGGAGCGTGCGATCCTCTTTGCGTGCGTTCAGTTTGCCATTTGCCGCGAGGCAAGGACGCGCGCTGGGCGGCAGAGTTGGCTGGGGTCTACACAT
GACACTGTCGCTCGAGGCCTGGAGCGCGGGTGGCTGCCGACGCTGCGTCACTGAGCGTGGGCTCCGCTTCGATCCTTCCGTCGATCCCATTTGCGCGAGG
TTTTTAGTAAGCTTGACTCTTTTGCTGCCTCCGAGTGCAAGGTTTTATCTGGAGGTTTTCCCACTCGACTAATACAGACGTCTATTAGTGCACCGACTTG
TCTACCTGCATTGTCTTGTCTTCCTACATTATCTTGACGTCCTGTACACATAGGAAAATGCGTTGTAGACTTGCATCGCCGACTGCGTTGAAGTGAATCG
CCAGAAACAGATACGACACAACCCAGCAGCAAGATAGTCCAAAGTGGTTCGATCTGGATTCAGTCCATATGCATTCTGGCATCTGACGCCATGGGCGATG
ATCATGCAACGTTGCCTACTGCAACGCTCGATCGTCAACGTGGTCATCGTCGTCCTCGCGCTCATTCGATAGGATACCACGGTACACGCCGCCTTTCTTG
GATCGCTGCCGCCGGAGCTGCTTACGCCACCGCTGGCAGCCGATCCGCAGAGCGGCGCTTTGTGCCTTTCTTCGCTGCTGACGAGCGGCGACGGTGTGTT
ATCCCGCGCCTCAACTGCAAGTCACCAAAGCTCGTCGATATCGTGACTGCCGCCACGGTGCCATGATGTGTGGCGCCTGGTCGCCAACCGGCTCAACTTG
GAGGCGACGAACTACTGCGCGTTCGTCGCCAAGTGGATGGCAAAGGCCAAGTCCAATTCGCTTTAGCTGACCATGCGCTTGGGCGCGACGCGTGATGAGC
TCCGGCGCCTTCACGCGCGCACATAAGCCCAGAGAACCCGGTGTACGGCTTACGTACCATCGCGTCATTTGGAGCTGCCGATCTACGCCTTCTCGCGACG
CCCTCGCCTCGTCACCGACGCTCACCAGTCTCTACTTGAACGCGTCAAGCCAGGTTGTGGTGCATGGCCGGCCGGTGCGCTGCCATTCGACTTCACAACA
AGCCCAGGACTACTGTATGGCGCTGGACATGCGAGCCGACGGCCCGGGCAACCGAGGTTCGACTTCGCTTCGACGCGATCGCCACCCACACACTCCAACG
ACCGTCGCCTCCATTGTATAGCGTTGATAGAACGCGGTCGAATCGTCCTTTGTACAAACATACTACTCTACCGTTACAAGTCTGGTTGGTGACGAACAAA
GAAGAAGAAATCTGGTTGCGATGGCTTTTAACAAGCGCCAAGGTCCAGCTGAGCAATGGAAGGTTCGTCAATTTGGGTGCCATCCGGTTGGGTGCAAGGC
GACGATGTGCTGCAAACGTGCGGCGTCCCTGCGACGCATCGACAACTGGATGGGTTCTGGTACGCTTGGTGCCACACGTTGGAAAAAACCAGCACTGGAT
TTTCCGTCACTGGATTTTCACGCCCGCCGATTGGCGGAAAGTCCGCGCGCCTTTCTCTCGAGCATTACGCGCGGGTGGCCGCTAGCACGTTCAAGGTTGA
AGTTGCGACGATGGGTGCGTTCCTTAATTCCCTTCCGCTGCTCACTTCAT