Description :
Non Conding Region
Location :
Scaffold_1:116730- 119546
Sequence
2816 bases(100 bases per row)
GGGGTGGGGGGCTCGAGCTCGGATCGGATAATGAGTGCCCTTGGAGGGTGTCCGTTCACTTTTTGACGCAAAGACGCGGTAAGTTTGGCATGGTTAATCA
GGGTGGGGGTTTCAGCGAATGGGAGGAGAGGAGAGATGTGATTGGTGCAAAACGATTATGGCAACTTTGCGACAACTTACCGAATTTGTTTTGTAGAGGG
ATACACCAACCTATGGGATACAGGATAGTATTAGCCAATCACAATTGTGCCTTCAGATTGACTGAGGGATACACCAGTTTCAAGCCAGTAATTTTTGCAC
GCTTGGCCGCTCAGCGCGCGATCATTACTGCAACGGTGCGGGCGCCACCAAGTCACCCTCGCCTGTCTGGAGGTCAAGGCAGGTGGAAAACGACGCGGGC
CCTGCTGCAATGAAGAAGGCTATTGTCGAGCACCTGAGACTACACTGCAATGTTTGTTTCACTGTAGATACGTTCTTTCCGGGTCTACCTACAGAAAAGT
ATCAAGGGAGAAGAGTAGTGGTGTTAAGATGGGCTCGTCGTTTAGCTCTATAGCTGCTGGGGGTGCTTCTGTCGGCGGCAGGCACAAACGCAAAGCTTGC
TGTACTGAGCTTCGATCCAAGTTGGGGTGGTGGCGGCGAACAAGCTAGTAAGCTGGGCTGTGTCGGCAGCCGCATTGGTGAGATTCGGCCTTGAGAGACT
TGAGGTAGAGTGCTCAGTTTAGTAATTTTGATAAATACATCTGGGCGTCCGGTGCCGATTCGTTTTTTGAGCAAAATCGGGCGTCTGGTATTTTAGCTCC
GGTAGGGTGTATCCCACTACAAAACAAATTCGGTATTATGGGGAAGTGGTACAGTAATTTACCTCAATAGCGCAGTCGTGGTATCGAATACCCTGCTGAA
ACGAGTATCTGTGCACACCCCAAATCGAGCCAATGAGAGTTCAGCTAGCCTCTCCTATGCAATTATCTTAGAGAATGTATAAATGTAGCCATTGCGCTAT
TGAGGCAAATTACTGTATTGCCGTTTGCAGATATTTTGGCCCTCGCGTGCTTATTACTTATCTCGTTTACTAGTATAGCAGCAGCCTCACAGCGAATACT
CGCCCCGGTAGCTAGAGGGGGCATTGCTTCGGCAAATGTATTATCTTACCTTCTCAGCACCGCCTCCCAGCACCCTTCATGCGCACGTTCTTAACCAAAT
TGGTTTCAGAACATATCCTCGATGCAGCTAGTCAAGCTGCTTCGTTTGGGTCGGCCACTGCCACGAAAAGCATCTTCGGCCTCATGAGCATTACGAGCCT
CTTTCAATGATATGTATCTAACTCAAAATCCGCTTTTGACGCATTAATCTCGGCCATCGTCGTGGAAAATACCATTGATAAAACCAATTTCATAGCAAAT
AGGAAGCTCAATTTATGCTTGGTAGGATTAGTCCCCCCATGGATATCTCACATAAATTGCAAAATAATATGTAAATATTACTGAGTACTAACTACTCTAC
CATCTACTGTAGTTCATGTACCATGGTATTGGTAATAGTGGATAGCTGCTAGGTAGCCGAGGTAAGCCAACCGCCTGAGTCTGTTGCTTTCGTATTTTCG
CTCAACTCAGATATTAGTGATAATATCTTTCAAAATAAGAAAATAGCACCAATATTAATTGGGGAGGGCTGGCGAATTGGAGAGTCCATTCAATGTATTG
CAATTTGCTTAGACCTGGTCTCCATGCTACAGTAGAAAATAAGCAATCGAATCCAAATCATTGTTAGTGGCTTTGGTATTGAACACTCCGTGCATGGCCG
GGGTTAGAAGGATGGTGCTTTGATTCGTATTTACGTATACTTGCTACTACTGAAAACTGCCATTTAACCTAACTATATTGTTTTTGAATGACTCAGCGAT
TGCTTGTTAGTATGCTGGGATCAAGTAAACGCATTCGTCATCACTGATGTCAAAGGGTTGTCCATCGAACTCTCTACAGTAGCTAGCAGTCGCAACTTTC
GTTCATTTTGGAATTTACCACCAACCAAGTCAAGCACTCCACCACCACCATGGCGCCTGCAAGTACCGAGGACACCAAGTCTGCTGGCATGACCTACCGG
TTCCTGGGAAATTCAGGACTCCTTGTGTCCAAGCTCGGACTGGGGAGCTTGATGCACGCCAAGGAGGAAAACACACCGGAAGCCTGGTACGAGATGATGA
AGCTGGCGTTCAAGCACGACATCAACTTCTTCGACAACGCGTCGCGGAAAGGAACATGGGCAGACCACTTTAAAAGTGGCAATTGTCAATTTCTCCACTT
TTTGCTTTAAAGTGGCACATTTCTCGGCAGGAAGTGGAAAAAGTGGAATCCATACAATACCCAAGTATAATTATTAACCGTCTGGCTAAGTACGAGCCTA
AAGGTGGCAGACACATTGCAGGTCAGTAGTAAGTACTTAACCCCTATCTATGGATACCTTTTGTGTTAGACTGCGAGCTCGCTGTGCATCGGATCGCTGC
CCCCGCTGCCACTTCCAAACCTCGTTTTACATCGATCAAAATACGTAAATGTATAAATTGACAACAGCGGCAACCGCATACCTGCATACGCGTGCCGGCA
TGGTGTCCCCCTTCGTGGCTGTACGGAAACCCCGTCTTGCTTCCTAGCTTCGTTTACCGCATAGTACACCTATGACGCCTTTGCGTCGATGAATCTTACT
GCTTGCGTTGATGAGCTATAACGTGCGAACTTCGCTATTGCCTCAAGTGTATTTCGCTACGAATAGAAGCACAGTCGTGTTCGTCGACTCCAACAGCATT
TTCGCAGTTTCCGCCA