Description :
Non Conding Region
Location :
contig_1:116725- 116997
Sequence
272 bases(100 bases per row)
GTCTCCAATACAAAAAGTTGGTTTTGGTCCAATCATGCAATGTGAATGACGTACCCTGTTGCAAGTCGAATGTCTAACATTAAGTTTACCACCGTAAAAG
GAACCCATGAGCTCGTGCAGATAAGGTCGTGCACTGGTAATGGTGCCGCTAAAAATGCAAGCAGAGCTCAAAGCGTGACTAGCAATGGATATTTCTGTCG
AGGTGAAGAGGGCATTTGAGATCTGAACGAGTTCCGCACAAGCGAATAGCTTTGTCCGCAACAGTGAAAGCA