Description :
Non Conding Region
Location :
Scaffold_1:116648- 116673
Sequence
25 bases(100 bases per row)
CTGATTTATGTAACGTACATCATTT