Description :
Non Conding Region
Location :
Scaffold_1:116448- 116675
Sequence
227 bases(100 bases per row)
AGATGTGACGGGGACGATTAGCAGTCTCTCGACCAagcagccagccagccagccaacACTTGTAGTAACTTATTAGCTCAGCACTATGCGAACGCGTTTT
AGTCATATAGCACCAGCTGGCGTTGCCACCCCTAGCTTCATCGGAGGCCTAGAACGATGTAGCAACACTCAATAATTAAACGTTCGCCTTTGAACTCAAC
ATCGCGCAGGTAACACACTAGACACGC