Description :
Non Conding Region
Location :
Scaffold_1:116438- 116890
Sequence
452 bases(100 bases per row)
aacaggctattcggtgattaatatcatcactcaaaccatgggatatacttcgaagtaggatggaggtcaacgctacgtttggcaagaagatatctccttt
gcaatttttttcttgcctaagtgttgcttgcagattgtttgcagctgttgaacgcttactgtacggtagctgaatccttcgagtcttggtgcaagtgttg
gaaggaactacatgctgtgcccgtcttcctgttttggttcagcaaggcaattgctatgactacatacagaccgctacagttccttgaagagcctcaaact
ccattgattcgcccttcattttcgttataaagacgccccactcaagctagctgatgctacaaaactgcatcaatctgtgctccgtttcccgctgaggatc
cgtgaccatcactggaagctgataggacatcctctgtgtgtctgtgtttttt