Description :
Non Conding Region
Location :
Scaffold_1:116419- 117708
Sequence
1289 bases(100 bases per row)
ACATGGTAAAGCGTATGGCGATGTCTATCATTTTGCAACTGTAAATGTTTCTTTTAACGAACGCATGGAATACGAGTACAATACCAATAGGACTACAATT
ATATGTGGGGCTCTACGGATCATGAGATGAGATGTATTTGACGCAAACGCGGCAACAGCCTCTATGAAGTTTCCGTGGAGCAGAACGAGGACCAACTTCT
GTCATCATTTACCAAAACAGGATCAATTCGCCTTGGTCAAAAACAAAGGCGCACTGCTATTCCGTCTTCCGTTTGCAATCTGACTACCGTTGCTGCCGAC
CACTATAATAGCGCTTTTGCTACCCTGCGGTCGTCGCATTACCAGCTTTTGGACGCCTGGCCTATCAGGAAGGAGCCGGTGGAGGCAATAGTCTGTGCGC
AATTGATCATCGCACAGAATACAACAGCAGGCGGCAGGAAGCAAAACAGAGCGCGTAGTACGACCTGCTTCTTTCACTGTGGAGTCACCTGTGCACCATC
TGTGATTGGCTGAAAACTAAGGATCTGTTTCTGTCACACACAGAACACTCTTACTCCCTTCGCTCTCACTTGAAGCGTCTCAGCTACCAGGATCTCTCGA
TGTTCAACTAAAATAAATGGCGGAGGTGCCGTTGAAAGAAACGAAAACAGCCATGTCTGGTGTTGCGGTTAATGTTTAAACAAGCCTAACGACGGTGGCA
TGCGCTATGTGAACGCTCGTAGAACATTGAACATGCAAAAGTGCAATCGAGTACCGCAGTTGAGCAGGGGCAGGTGTGGTGCGATCGAAGACTGTCGTGA
GTGAAGGACACTGGTCTGGGGCAATGCGAGCTCGGATCGTTGTCGATGGCACGATCGTCATGCTGCCTGGGTCAGCATATTGGTGTGTTGTTACACACAC
TCACACACACTTGCGATAAGATGGATACAATTTGGATAGTTTGTATCATACAACGAATTCGTTAAGATCGATTGCATTTGCCAATGTACCGCATACACTC
GTTTAAAGCAGACAAAAAGAGTAGGTTATATCATTCTTAGAGGAAACCGGAATGCGTTTGGCACATGATAGATCCATGCTTGAAGTATGCAGAAGCATTG
CTTCAGTGTGCCTCGCCGGTCTTATGGGTAAGATAAATCAAGTGTAGTATCCCTGTTATCAGGTTGAAGCTCGCAATTTCAACCTACTCTCATGCACCTC
CGCCCATCCACCACTACACACTGAAGTACCGGCCGTCAGTTGTTGCGTGTCATTCTCAAACTTACCGAAAAGGATCAAACAGACGACGA