Description :
Non Conding Region
Location :
Scaffold_1:116258- 119672
Sequence
3414 bases(100 bases per row)
CGATGCGAGTGGAGTTTCCAGACAAGCAGCTAGTCTGTGTTCCGATCGATCGCAGACCGGAGGATGGAGACCGCTCTATCAGCTGGAAAGGTGGCATCTC
TCGAATAGATTTCTTTCTCTCCCCGCCACCACTGATGGGTCCATGCCTACAGAACGAAGCACCATGCAGTGTAACATGCACAACGAATCAATGCAAGACA
TACGCAATACCCTACGCTGATGAAATGCACATGCAAACAGAAACCAGCGCAGTCTTCACTGCAGATTGTTGGTGCGAGCCTCGCCACTGATCTCGATGCC
ACGGAGCTCTGCTATCGTCAGTCAGTCGCGACGAAGGAAGACGAAGAAGATAAAGGAAGACGAAGACGAGCCAGAGCGCGGACGTGGCGACAGGCTCCTG
CCTCCAACGGAGCAGTGCAGAGACAGGTAATGGAACCAATTTGGTGTCCCGGGAGGCGAGTTGCCCGCTGCACGTGCGCGGTGAGGCGCAGGAAGACCAG
GTAGCCCGTTCCTAGTGTTCTGTTGCTAGTCCTTGGAGGAGCTGGACAGGGATGCGGCGGTCCGCGAGCAGGTTCAATCACTTGCCGCAGATGCGTGCGT
GGAGGCGATTGTTGAGCTCTCGGGTTCCAGCTGAGCAGGTCGCTCCGCCGCAGCGATGGACTTGCTGGCCTTCCCTCTCGATTGATGCGATTTAGAAGCG
GCAGCTAACAGGGAGGCGATATATTTTACTCGGAAAACAGTTGAAGTGCATTTTGTGCCAAAATACAGATCTTCAGAATTCGTCGTGATTGTATGCGGTG
CACGCAGTCAGTTCGCAACATTTAGAACAGCACTTTTGCTTGAATTGCAGAATCACATAGAACTGCACAAAAATAATAAATTTGCTCTGACGAAATGAAA
ATTATCACAATTATAGCGCCAATCCTGCAATGTGCACAATTTCACCATCCAAAACCACCAGCTCATATCTGATGGTGTACCTCTGCAGCGCAGTTGCAAT
GAACATGCAGGACGCCCAGCTAGACCAGCAACCCCCGAATAGTTGAACCTCGACCTGTCCAATTCTTGCCCGCTTCCACCCGCGTTTAGTCCCGTTCTAG
TCTCGCCGACGTTAGTCGGGTTAATTCTGCAAGGATAGCGCGACTGTCAGTCAAGGCAAGTGCACATCGTTGATGCTGCAACACCAACAATTTCCGTCGT
GGGAGCTCGCTCGACAAGACGGTCTGTTGGCTGTCCTTGTTCGATGTCGCATCCTCGTGGATTGTTGATGAGAGAGCTCTCGAACGAATGGGGGAATCTC
ACCGCCAGATGAATTTGCAATGACAACCAAGCGAGTCAAACCACTGGGAATTCCGGCAGGTGCCGTCTTTGATGTGTGTACAGACAGCGCTGTGCCAGGA
GGTCACGCGCGGTCCATGTTTGCATCGCTGCACAGCTTCAACCATGCTGACAGCTCAATAAACTGTCAAAATTGATCAAATTGGATTAAAGTAGTATTTT
GTGTGCTCCATCTGAAGTTGAAGTTGGAGATCACTGGCTGGTGCATGGATTCCAGAGGTTTGTCCTGTTCTCCCTCCCTCCCTCTCGCGCGCGTGGATGC
CTCTACAGTGCTGATGGAGAGTCCGAGTCCGGTAATATGCGATGCGAAATTGCCACATAGGACCAATTGCGTGTCTTAGCATTGTGCGGCAGGTGCCACG
ACATCGTGTGTCAAATTTGCAGTTGGTATCCAAGCAGTCCGAATCATGTGCATGTGTGCTTGGTGTACTGCGTCCACACTACGGTACGATACTGCAGTTT
GCCTCGGTGGGCTGGAGTGCACAATGTTTATGCCGAGTCTGAAGTTTCAGCGCTATTTAGTCCGCGCGAACGTGGCATTCCGAACCCAAGTCGCCTGGCG
GTCATTAAACAGGTTGAAGAGCAACAGCGGCGAGCCACGCGCAAGCGTCATCGCAAGCGCTTCGAAGGAGACTATGGAGAGCGATCGCTGAGCAGCAGTC
GCAGTTGAAGTGGCGCGGGTCCGGTCCGGCAGTGATGTGTGGAGATCCGGTGTTCCTGTGTTGGAGGTGATGGGGTCTCTCAAGTTTTTGATCCCTTTGA
TTTCGAACAAAATGTCGAAAGTGTCGTAAGACCGCACAATTTGGGAACATAGGAGTTTGAGAGTGGGCACTTCAGCTTGTTCGTGAGACCTCCGCCCGTC
TTTGGCTGACCAGGCAAAGATGCTGAGCCGTGCGCATGTTTCGCGGGGTGTATTTTCTGCAACGATTTGATTTGAGAAGAGCCTCCAGTTTTGGGAGACA
GGATTATGCGCCAGGTTTTCGGGAAAGTGCGGTGCCATTTCGATACTCGCTCAGATCTACGAGGTTATGCGTTTTACAGGTCTGCATCCAAATTCAAGTC
TATGCATATGCAAAACAAATATCATCAATTATACCGACAATGCGAACATGGAGTATCGAATGTATCGTAAACAGTGGATGGCCTTGCTCAGTTCCCGTCA
AATAAAACGGACGAAATGCTGTACACTCCCGCCTCTACTGCATAAACGGTCCACTGCGAGTCACACGATTTTTATCCGCGCTGATTCAGTACTCGTATTT
TGCCTTTTACTGACATGTGACGAATTATACTGATATAAGAATAATAGAGTACTATGCAATATCAATGGTGTACTGATATGCCGATAGTTTTTGGATCAAA
AATGCACTGTCTTTGGTTCATCGCTTTCTGAAGCTGGATGCATGCAAACGGCCAGGCTTTCACATCGAATCCAACGGCTAGCTCGTGCCTAACTTGCGTG
CCCTGCTCTCCGCCGTTGAAAGCGGCCAAACGGGAGATAAATGCAATGATCCAAGGCGATGGAGAACGGGTTGGTGATGGGACATCCCGCTGAGGGTCCG
AGCATTTCCCCGACCTCCCAATGACACGGTGAATGCAACCATCAACGCCAGGCATCAGGTTGCAGCTCGCGCCAGTACAGCTGTACTCTGCGATGGGAGA
CCGACTCAAGGATCGATCGATCGTGGCCGGTGTGATAGTGGTTGAACTTGAGACCGGCAGGCAGATGGGAGTTCGCCGCAGCCTCCCTGTCCGTCATGCT
GTCCACGAGACGACAGCACCCCTCAGTTGCGAGCACGCGAAGAAGTCATTCTTTCGGCGTCCCGACTCGCAAGTTTCTGCACGGATGCACCCTTGAACTT
CGCCCGGTGCAATCGAGCCACACATCACGGTGCCAGACAGTCCAACGGACCACCAGATCAATCGCCAGACCGAGAGCACGCGTTGCAACATTATGCACTG
GCTCGCGTCCTTGCAGCGAGCGCCGTCGCCATCCATCACGTTCCCGTCACTCACTTTCCAATTTGCGGCCACTTGGACACGACCAGCCCAGCCCAGCCTC
GCGACAAGTCAAGA