Description :
Non Conding Region
Location :
Scaffold_1:116139- 116753
Sequence
614 bases(100 bases per row)
GGAGCAGCAATAGGAGCTGGTTCCGCTGGTACTAGCATATCTGGTTCCACTGGCACCTCGAGCTCCTCCACATCTACTTCAATGGGCGGCAGGTCGTGAC
GCACCATGGGTTTAAGTACGACGGAGCCCCATCGGCGCCTCATGCCCAGCGTTTTGACGTACAGCAGGCGGTTGCTCTCCTGCGAGCGACCGCCCTCTCC
ACACGGAGACTTGAACGGGCGGCGCACGTGCTGCGCGCGACGCTCCGGCTCCATCACCAGGAACGACAGGAAGGGTAGGCGCTTGACAGCCAATGACGAA
CCGCTGCGCAGCGCCTGGCGGTTGCTAGCAGCATCGTCGTCTTCGTATGTGTCGTCATCTTGTGTCTGTGGTTTGCCCCTGACAGGCAGCACGAACGGCT
TGAACTGCGCGCCGCCATTACCCGCTGGTCTTCGACGCAGCATAATGTATTTAAACTGGCGGAAAGGAAAATGACGATTTGATTGGTCCAAACAGTTTGA
AGACCATCACTCAGCATGAGCAAATGATGGGAATCATTCATTGGTGGAAAAGTAGTGGATTATAAGCCAGTGTGAGGACAGACGCTAGCGGCCGCAGAAC
TCAACGGTGTAAAA