Description :
Non Conding Region
Location :
scaffold_1:116124- 116227
Sequence
103 bases(100 bases per row)
GGTGGGTGCTCATTTTCAGGTTGGAGGGGGAAATGCTGCTGCTTTTCAAATAGATTTCAATGATTCTTGCTCTTGGACAACTGACAGACGTTTATTGACG
GAT