Description :
Non Conding Region
Location :
scaffold_1:116091- 117412
Sequence
1321 bases(100 bases per row)
TTTGTCTGAAAGGAATTTTGCAATACTGTCGAATTTAATAATTTATGTTTGGAGAGAGCCTTCTAAACGTGATATAGATGCAAAAAGCAACAATGAAAGG
GTATCTGCCACACCTCTACAGACATCTTCAGCTTCCCTACGTCATATTTCTTGTCCGTATGTGCTGCATTGTTGCGGCGTTGACTCACGTGGGACGTGGA
TGCCATCCGCTGCCCAGGCAGCTTCTGGTGCAATGACAATCAGGTGTCTTCGTCGCGCCCAGGCGTCAGTTTGATGCAGAGTCTCTGCCGATTGCCAGCT
CTCCTCGCCAGCTCTCCTCGCCAGCTCTCCTCAAACGCAGCTTCCACTTGGCCGATGGCACCATTCAAATAACGATCCAGACGATGCGTGTCGTGCGAGG
CTCTCGGTGGGCGTCGACTAAGCCTATCATTGCGATGAGCCCCTAATGCTCTTCGTACAGACGCGGACGTCACCGTCGCCCCACGCGTCGAATCCAATAC
CAACGTTACATGTACTGTGATATAAGTGGTCTGGTTGCAAGCGCCGAGCTTGTGGTGATCTGGCAGTGCTCAGCCTATATCGTGCTAGTAGCACGCTAGT
GGCGAGCACAAAGCTCGCGAGTGACTTGTTGGCTCGTTGCTCTCTGGTTTCGATGCGTCGCTCGCGTCGTTTCGCGCAAAATGCCAATTGTGGGAATTTG
CCATAGATGGGCAAGTTCAGGTTATTGTTTACGGTCTATTTGTGGGTCCGATCTCTGATGTGTTTGGAGTCGAAATTTGAGCACTTAAAAAATTTACCGA
GTTCTCGAGCTTTTACCCACAGTGACAACTTCTACAAACTGTAAAAGCCACGGATACAGGTGCAGGGTGCGTGGTATTAATAAGTTCTTGAAAGCAGTTA
GTGTGTGAATTTCATAAATACTTGAGCTCCGGGTCAACAACACCTGCCCGGATCTATGCTGGATTGCACTCGATTAGGCCTATTGTAAACGAGAGCCGAT
GCATGTTTTACTCAACGAAGCAGATGCAGCGCGCACGCACAAATAATCAAACACTTGAACTGCTTGGCTGGCGTTAGCATGCAAACAAATACTTCTCTTC
CTAGCGGCAACTGCCACATCCAAGCAACGAAAAGTGGCAATCCTCGTTCCGCCCTTGCCCTTTCGTCAGCCAATCGCGTAGCAAGGACGGGCTGCCCTAG
CCTCGTCCGTCTTTTCCATTCATACAAATTTCAAGTCAATCTCGCTGTTCAATTAATTGTCCAATTTCGCTCACCGTGACACCATTCTGCCATTCTCGGT
CTATCCCACAAAGGCGAAGAA