Description :
Non Conding Region
Location :
Scaffold_1:115915- 116047
Sequence
132 bases(100 bases per row)
gctcagtataacatcaataacttacttcaatgcattttagaactgacaatttatttaaactcaatatatatttttgaattgggtcacaataatttcctca
ttttgcacttcccaagcaacatggtgcgtgaa