Description :
Non Conding Region
Location :
Scaffold_1:115908- 116067
Sequence
159 bases(100 bases per row)
TAAACTATCGTCGTGCGTGCTATCTCACGTGTGCCTTCTGCCGCGTTGCATCGCAGGAGACGGGCTTGGCCAGCTATCGCGGTCGCCTTTGTCGAAGGAC
GCGATCGCGGCGTCCCTCGTGCGGCCTGCACCAACCCTAACCCTACAAGGAACGACAGT