Description :
Non Conding Region
Location :
contig_1:115676- 115778
Sequence
102 bases(100 bases per row)
GGTGGGTGCTCATTTTCAGGTTGGAGGGGAAATGCTGCTGCTTTTCAAATAGATTTCAATGATTCTTGCTCTTGGACAACTGACAGACGTTTATTGACGG
AT