Description :
Non Conding Region
Location :
Scaffold_1:115563- 116403
Sequence
840 bases(100 bases per row)
TTGACCATGTTGCTGCCTTGCCGCTTCGATCTGCGGACGCTTCCTACTTCTCCATCGCACGGGATATCGTAGCCATAGCGCTAGATGGAAGCGTCCTTGC
ATGTGTATCTCGTGCTTGCTAGTAATTTATGCTAACCCTCACGCCAAACCCGTGTGTCTCTCGTAGGGCCGACCTCTCCACCCcTCCAGTCGAGGAGGAG
ACCCCAGTTGAGCCCCAAGCCGATGAAGGAGGATCTCAATGACGAGACGCATTGCGTCGGGCGGTCTGAAACAAACCCGCGCGCAGTCGTGGTAGGCACC
GTGTGTCCCGCAGAAATGTTGGTCGCGGGAACGCCGCCATACTGAGGCGCGGTCCGTGCTGATAGACGTATGTTCGGAGCTCTCTTCGGAGAGACTTCGC
CTGAGaGATCCTCCTTCGATGTGTATTGAGCGAGTTTGAGGTCGCCGTCTCTCGCCTGGAGCGTGGAGAGGAAGCGCCCGCTTCCTCTTCTCGTTCCtCT
TTGTCCCGCAGGCACCATCCTCTCTTCaTAAAATCGCTATTCAATCTCATGTGATTCAACTATATCCTCTTGCTTTGTCTATTCTTGTGGCATGACTCGC
ACACTTGCAGGCCACTCACTCTGCATTCAGCATGCACCGCGTCAGGTACTGCCATCAGCTGGAATCTCCTCACCTCCAGGGCTGCACTCACGTGAACCTC
CTCATTCCCcAGTGACCACCTCGTCGACCGTCACCCATACTTGGACCCcGGGTTCAAAGACGCCTACGATCCCAATGAGGTGAGATCCCCTGCAACCGTG
TGCCGTGCCTCCTCTCTAACTCACACCTCGCCCATACAGG