Description :
Non Conding Region
Location :
scaffold_1:115500- 115557
Sequence
57 bases(100 bases per row)
AATTTACGTGAATTAATACGACGAGGCTTCGCGCAGTAGGTCTCTGTTTCAACCTTT