Description :
Non Conding Region
Location :
Scaffold_1:115450- 117499
Sequence
2049 bases(100 bases per row)
GCTATTGGGATTCCGGTTGCTTTTCTTTCTGGCAATGGACGCGTTTATATTCGTCCTTGCTCACTCCACTTGATAGTGGGATATTGCAGTTGCGGAACCG
GAAGCTAAGCGCAAGATCAGAAAAAGAAGAAAGAAAAAAGGCGAAGATTCTGGTTTTGTGTGGGTCTAGTGATCTTGCTCTCGATTTGAGTCAATCTAGT
CTTGATATCTGTTGTGCTTGGGATCAGATTGCCACCAATCACGTGGGACTAGGACGCACAGGATTAGTAGTGAAGGTATTGTTTTAGTGGGCTAAAGCGT
GGACTTGATGTTGGCAAAACCTGTGAGGGACTAAAAATCTTGGAGTCAATAAACCACCCTAGGTCGTCTGTATCGCGTATAGGTCCACCGCATGGCGATG
TGTAATAGAATAGTTAATTGGCAGTCCGACGCAGCACATGTCAAATCGGAGTGAAGGCATGCAATGTGCAAAAAGAGAAGTTCAACTTGATTTAAAATCC
GACAAATACACCACAAGTCCTAATACTATTTGTAGTTGCTGCACACTTTCATTTTACTCGGTTGATAGCCCACTCAAAGATCAATTGCGGCGCAGAATTT
TGAAGAATTTTGACAACAACAACGCAGGTTTCAGTGGAGAGTAGTCAAACTCCGCGACTTCCAAGAATCCTTACTATATCATTTCGAAGCTAGAAATATC
GCTTTAGACACCCGCATTGAATGAGAGGCATTTTTCAGTTGTGTTCGCTAATACAGCGCAAATAGCGAAGAATGAAATGCTATCCTCGTTGGAATGCCAT
GCAAGTCACTTTAAACACGTTCAGCATTGTACTTGAGGCGCACAAACTCACTCAGTGCTTCATTGTCTTGGTGGAAGTAGGTTGCCGCGTAGCTCTGGGG
GGTGGGTTGTGGTAATTGAGCAGGAGGCTGAGAAGGGCGTGGATAGTCGAGAGGTAGAGAAAGTCAATAAATAGACTGCGGAACGTCTTCCGTCACTCAC
ACTTGCATAGGTTTTTACATAGTAGAAAGTGAGTGATTATGGACAGAGCGTCCCAATCAATTATTGATCTTAATTGATATTCCATATTGACTGATTAATT
GATTTAATTTCTTGAACTTCTGGGTGATGGACGAACGATTCTTTTGAGGTCGTCTACGCATGTGTTCAGTTGAAAGTTGTCTATATTACTAGAATTAGAC
GAAGTGACTCAATCTACCTAGCTATACATAGATACTCTACAGTTCCACGCATGTGTTCAGTTAGCCAGACACCGTTCGGGCATTAAATAAGTAAACATTG
ATTGATAAAGCTCTCTAATTATCGAATCCATTACGTGTATTATCGGATCCTTCAGACGCTGAATATTTGTCTCTAAACTTCAGAGGCAACAATAGGGAAA
GCATGGCTTCCGTACAAATACGTTTGGGAAGGGCTATGTGTGTATCTATGGTGGTGGGGGTGATGAACGGATGATTCTTTGGTTTGCCAACCATACACAG
ACAAATATTAGTATTAACCTTTAATATTAACCCATGCACACCACATGGACCTTATTGATGTCCGGGCCTTCCTGTCTGTCCGTCTGTACACTGCTGTGTG
ACAAAGCTACAATTCAGACGAGTCACGTTAGAAGTTATCGAAGACAGCCAAATGATTATACAGCAGATGCAAGGAACAACAGCGACTAAAGCTTCGCACC
TGATTCCAATCGCGACACGGATCTAGCGCCTGTGTGGCAGCTTCAACTGGGTGACACGGGTACATATCAAATGCCACCTTAACACGGCAGCTGACTTGCT
CGCCAACAATGCCATGAATTCGAAAACCAGCATGCAATTCACTGTACGGAGCACCCCAGCAAGTAGCCAAATCTGGCAACGAGCCATCCAGTTCCTAGAA
GAAGATGACAAACCAATGCCAACACTTTTCCAGAACTCAAATTCAATAGCTCGAGCTCTCCACCAATTCAAGGATTCTTAAGCAATAACCATTAAATAGA
ATACTTATCATCAAGTGCACTGCTGTATCAGTGGCGTGCAATCGCTAGG